Special Issue

Fruits
This special topic selects papers related to Fruits(Apple,Pear,Peach,Jujube,Grape,Strawberry,Chestnut,etc) published in Acta Agriculurae Boreali-Sinica (AABS), involving papers on Fruits genetics and breeding, cultivation, physiology and biochemistry, soil fertilizers, diseases and pests, etc.Click on the relevant paper to open the web page and download the full text. In order to quote and share for readers, each article contains a complete citation format in Chinese and English (including international DOI number) and a proprietary  QR code. Long press the  QR code of the article to open the web page of the article and realize mobile sharing at the same time. Thank you for downloading, quoting, forwarding and sharing.
Journal
Publication year
Channels
Article type
Sort by Default Latest Most read  
Please wait a minute...
  • Select all
    |
  • DONG Yue-ju, ZHANG Yu-gang, LIANG Mei-xia, DAI Hong-yi
    Abstract (823) PDF (676) RichHTML
    Baidu(19)
    For ascertaining the main evaluation factors of apple fruit,Nine quality index were measured of fifty-eight varieties.The index included mean individual fruit weight(MIFW),fruit shape index(FSI),flesh rigidity(FR),total soluble solids content(TSS),titratable acid content(TA),pH,vitamin C content,carotenoids,the ratio of sugar acid(RSA).These data were analyzed by variation,correlation analysis principal component analysis and system cluster analysis.58 varieties of fruit quality were analyzed by variation correlation,nine index were compressed into six integrated variables using principal component analysis.Final main evaluation indicators of apple fruit were determined by using cluster analysis and correlation analysis.The results indicated that the range of variation coefficient was from 5.7% to 77.8%.Mean individual fruit weight,flesh rigidity,vitamin C,carotenoids were the important components of fruit quality,playing a major role on fruit quality.These nine index were closely related and the relatively independent.Vitamin C was significantly and negatively correlated with titratable acid content and was significantly and positively related to mean individual fruit weight.Carotenoids was significantly and negatively correlated with titratable acid content and was significantly and positively related to the ratio of sugar acid.Based on the above results,five representative index were assured for evaluating fruit quality,that is fruit weight,fruit shape index,flesh firmness,contents of total soluble solids,and content of titratable acid,which could reflect the most information of apple fruit quality.
  • SONG Hui, SHEN Lan, ZHANG Xiang-qin
    Abstract (769) PDF (141) RichHTML
    To investigate the strawberry cultivars by molecular markers,Hongjia,Zhangji,Ningxin(Xiangmei),Aerbi and Mengxiang were used to establish the molecular fingerprinting and cluster analysis by RAPD markers.Four markers were screened from 112 RAPD,which generated five polymorphic loci.These RAPD markers showed the polymorphism ratio of tested strawberry varieties were 3.6%.Hongjia,Aerbi and Mengxiang could be verified,the fingerprinting of Ningyu and Xiangjiao could be established and the variation of Mengxiang population could be detected by fingerprinting markers.Finally,the applicability of strawberry molecular fingerprinting and the certain instructive effect on cultivars spreading of cluster analysis were also discussed.
  • ZHAODeng-chao, WANGJun-yi, HANChuan-ming, CUIShu-ying, HOULi-qun
    Abstract (734) PDF (2681) RichHTML
    The paper aimed that analyzing the fat composition and the differences of fatty acids composition and contentappear in different walnut varieties kernel by the method of gas chromatography(GC).The results showed that the fatcontents were about 66 % in all of the walnut kernel.12 kinds of fatty acids,including Tetradecanoic(C14∶0), Palmitic(C16∶0), Palmitoleic(C16∶1n7), Heptadecanoicn(C17∶0), Cis -10 -Heptadecenoic Heptadecanoicn(C17∶1n7),Stearic(C18∶0),Oleic(C18∶1n9c), Linoleic(C18∶2n6c), α-linolenic(C18∶3n3),Arachidic(C20∶0),Cis -11 -Eiscosenoic(C20∶1),Docosanoic(C22∶0)were detected in the six walnut varieties kernels.The carbon numbers of the fattyacids were mainly between 16 and 18.The fatty acids in walnut kernel mainly included Polyunsaturated fatty acid andMonounsaturatedfatty acid,less saturated fatty acid.The varieties of Qinglin and Yuanlin had the highest and the lowestLinoleic acid contents,reached to 42.19 g/100g and 36.12 g/100g,respectively.
  • ZHANG Guojun, WANG Tingting, HU Lizong, LI Shufen, GAO Wujun
    Abstract (726) PDF (210) RichHTML
    To extensively understand the sequence feature and evolution of heat shock transcription factors (Hsf)in the genome of apple,fifty MdHsf genes were identified using bioinformatics methods at the whole-genome level of apple,and a series of analysis including sequence characterization,phylogenetic relationship,gene expression and selective pressure of MdHsf genes were further performed.Phylogenetic relationship and sequence characterization analysis showed that,like the model species Arabidopsis and rice,50 MdHsf genes were divided into three subfamilies A,B and C.Additionally,at least two genes were found in the same end clades in the phylogenetic tree,indicating that the lineage-specific amplification had happened during evolutionary processes of apple Hsf gene family.Although the intron numbers and sizes of MdHsf genes were relatively divergent,the conserved motifs and domains of MdHsf proteins were highly conserved because of functional constraints.Based on EST data,72% of the 50 genes (except 14 genes such as MdHsfA2a and MdHsfA3a/b/c)had transcription activities.Selective pressure signatures demonstrated that no positive selection site was identified in the cleaned codon alignments for 36 MdHsf genes based on site-specific model,suggesting that this protein family was controlled by purifying selection.However,branch-site model had identified a total of five positively selected sites in the d and e clade of the phylogenetic tree,i.e.28R,30L,35D,51M and 67V.28R and 30L were included in the Hsf domains,while 35D,51M and 67V were not mapped on the region of Hsf domains,suggesting that purifying selection was the main evolutionary dynamics of functional conservation Hsf domains except for 28R and 30L.In conclusion,various Hsfs existed in apple genome,and the conserved motifs and functional domains were conserved.The majority of them had transcription activity,and the evolution of this family was dominated by purifying selection.
  • ZENG Guang-juan, LI Chun-min, ZHANG Xin-zhong, CHEN Dong-mei, ZHAO Yong-bo, DONGWen-xuan
    Abstract (722) PDF (1083) RichHTML
    Baidu(17)
    In order to develop an efficient protein extraction method suitable for SDS - PAGE analysis,five protocols for protein extraction in apple leaf,trichloroacetic acid/acetone precipitation (TCA),modified Tris - HCl extraction,phenol extraction methanol/ ammonium acetate precipitation,DTT/ acetone and Tris - HCl extraction were compared.The extracts were separated by SDS - PAGE method followed by silver staining. The results showed that the modified Tris-HCl extraction presented the highest resolution of 3. 243μg/μL and the maximum bands of 41 strips with the 5μL sample volumes basing on the increased amount of PVPP and the extracting solution as well as prolonged 30 min of protein precipitation with cold acetone.Dynamic changes of proteins in leaves from different nodes in apple seedlings (Jonathan ×Golden Delicious)were analyzed with the improved Tris - HCl extraction method,six protein bands were detected with the molecular weight 71.9,60.5,52.6,41.1,35.3,18.5 kDa respectively and the bands were clear with a light background.So the improved Tris - HCl extraction was the most appropriate method for apple leaf SDS - PAGE analysis。
  • CHENG Li-li, HU Guang-long, SU Shu-chai, HUANG Wu-gang
    Abstract (714) PDF (372) RichHTML
    Baidu(1)
    The objective of the study is to elucidate the genetic relationship and genetic diversity of Castanea species.Based on the technology of chloroplast microsatellite markers, of total 24 cpSSR primer pairs screened, only four presented length polymorphism in the Castanea mollissima tested.We surveyed 6 species, altogether 56 materials with cpSSR markers in order to estimate genetic variation and genetic structure.In the castanea plants, average number of alleles (Na), effective number of alleles (Ne), expected heterozygosity (He) and Nei's were 3.25, 2.554, 0.606 and 0.320, respectively.Apparently, the parameters of cpSSR loci were much lower than those revealed by nuclear SSRs.Furthermore, the intra-specific genetic diversity was high but varied greatly among different species, the wild chestnut in China showed the highest genetic diversity, which one was rich in heredity and variation.The results have important implications of understanding the population genetics and evolutionary patterns in the genus Castanea and provide baseline data for formulating the conservation and management strategies.
  • Chang Jiaying, Kou Hongda, Qiao Danna, Zhang Yanjie, Chi Guotong, Li Yaning, Li Xinghong, Liu Daqun
    Abstract (704) PDF (437) RichHTML
    Baidu(2)
    Grape gray mold caused by Botrytic cinerea Pers. is one of the most important diseases on grapes worldwide. The genetic variation of Botrytis cinerea is widely and adaptable,which is easy to produce drug-resistant strains. It is reported that Boty and Flipper transposon of Botrytis cinerea are related to the presence or absence of resistant strains. By setting different gradient and optimize Botrytis cinerea Flipper transposon PCR amplification system of grape in China, including template DNA,primer,dNTPs, 10 × Taq 10 Buffer,Taq DNA polymerase,annealing temperature,cycle indexthe 1 159 bp fragment was obtained ,which has 99% similarity with Botryotinia fuckeliana Flipper transposable element transposase gene through NCBI blastn. So the amplified fragment is verified as expected target fragment. The establishment and optimization of Flipper transposon PCR amplification system of the grape Botrytis cinerea in China provide an important foundation to further study of the relationship between the transposable elements,pathogenicity and resistant
  • Abstract (694) PDF (436) RichHTML
    疙瘩梨又名鬼头梨,因其在蜜梨上发生严重,故又有蜜梨疙或疙瘩蜜之称。被害梨果表面凹凸不平,果形变小,仅为正常梨果的三分之一到四分之一。在洼陷部份颜色变深,内部石细胞增多,组织变硬,甚至用刀挖切都觉费力。凸出部份的组织虽较疏松,但终因发育畸形,无正常梨的滋味,完全失去经济价值。被害轻者果形大小虽近于正常,凹陷也不太严重,但收购价格仅为好果的二分之一。在被害品种中以蜜梨最重,麻梨、白梨、赶宵梨等次之,酸梨也有翅度被害,但不甚明显。
  • ZHANG Wei, LIU Jian-ling, LIAO Wen-hua, LI Zhi-tian, YUAN Wei-han
    Abstract (648) PDF (454) RichHTML
    This paper studied that the responses of six-years-old Chestnut trees to N,P and K fertilizer and the distribution in plants located at Yanshan gneiss region were investigated in 3-year period.Influence of NPK fertilization on Chinese chestnut growth:comparing to-N and-K treatments,NPK treatment increased the leaf areas by 20.2% and 27.4% respectively (P<0.05),and the fresh weights of single leaves were increased with 6.7% and 13.7% respectively (P<0.05).However,there was no significant difference in leaf area and fresh weight between-P and NPK treatments.Impact of NPK fertilization on Chinese chestnut yield:compared with-N,-P and -K treatments,NPK treatment increased the yield by 23.3%,50.5%,50.2%,and the empty Chestnut shuck rate was reduced by 4.8,6.7 and 3.5 percent,respectively.The amount of chestnut per Chestnut shuck was increased by 0.7,0.5 and 0.5,respectively.In comparison with-N,-P and-K,the NPK treatment increased Chinese chestnut yield significantly by 56.3%,42.2% and 39.8% respectively.Aboveground uptake of NPK nutrients:the N,P,K uptake of the stem and leaves accounted for 70.2%,85.9% and 70.2% of the total aboveground uptake,where the uptake of Chestnut grain (Chestnut seed and shell) accounted for 41.2%,69.2%and 67.7% of the total.Of the Chinese chestnut grain,the N,P and K uptake of chestnut seed accounted for 29.8%,14.1% and 29.8% of the total in grain.Application of NPK in underutilized gneiss area increased the chestnut yield significantly,where the N application increased the number of Chestnut shuck per plant and grain number per Chestnut shuck and reducing the empty Chestnut shuck rate,meanwhile,the empty Chestnut shuck rate was reduced by P fertilization and the grain number per single Chestnut shuck was increased by K application;the order of the contribution rate of N,P and K for Chinese chestnut yield was N,K>P.
  • ZHENG Xianbo, LI Ming, TAN Bin, YE Xia, LI Jidong, FENG Jiancan
    The relationship between the open type,upright type,weeping type,broom type,dwarf type and compact type peach leaf vein structure and the different growth habits of peach tree architecture were explored to provide a theoretical basis for the breeding of peach dwarfing and high density by using different growth habits of peach resources and early selection. The characteristics of tree structure,leaf shape and leaf vein structure were observed by using six growth habits of peach as materials. Moreover,the relationship between the six growth habits of peach tree structure and vein structure were analyzed. The results showed:The average angle of the leaves in six grow types of peach ranged from 62.76° to 73.50° and showed no obvious difference among each other. However,the branch angle exhibited significant difference among six growth types of peach. For the basal angle of 1st order branches,weeping type was maximum(93.92°) while dwarf type was minimum (36.75°),the other four growth type were medium. However,the lumbar angle and top angle of 1st order branches showed the similar change rules in the six growth types of peach which displayed the maximum level in weeping type and the medium level in open type,and exhibited no significant difference among four other growth types. The characteristics of leaf structure in six growth types of peach were also investigated. The leaf length of upright type which was minimum (11.01 cm),while its petiole length was maximum(2.41 cm). The leaf length and leaf width of compact type peach was 16.2 cm and 4.57 cm respectively,and possessed the maximum average leaf area (47.28 cm2). All the leaf veins of six growth habits of peach was eucamptodromous venation pinnate. The number of secondary veins of upright type was highest while the weeping type had the least secondary veins. The open type had the maximum angle while the dwarf type had the minimum angle. Correlation analysis of leaf vein structures and tree structures in six growth habits of peach was performed. The results indicated that there was a negative correlation between the numbers of secondary vein and the top angle of 1st order branches in open type,dwarf type and compact type,especially in open type which correlation coefficient reached a significant level (-0.970). In another hand,there was a positive correlation between the numbers of secondary vein and the top angle of 1st order branches in the uprigh type,weeping type and broom type. In the open type,dwarf type and compact type,the angle of secondary vein had a negative correlation with the top angle of 1st order branches and only in the compact type their correlation coefficient reached a significant level (0.953). There was a negative correlation between angle of secondary vein and the top angle of 1st order branches among the other three growth types. The differences of leaf secondary veins angle and the numbers of secondary veins of peach veins could reflect the changes of different growth types of peach tree structure in a certain extent. It could be a morphological marker for early selection of different growth types of peach.
  • GUI Teng-rong, JI Pan, KONG Bao-hua, ZHANG Yan-ming, MA Yu-mei, CAO Ke-qiang, MA Jun, HUANG Wen-jing, YUAN Yuan, MA Xue-lin
    Abstract (622) PDF (288) RichHTML
    For importing new apple varieties into Yunnan and adjust apple variety structures,new apple varieties imported were need identified their resistance to Valsa Canker.Combining analysis of the investigation of natural infection incidence in orchards and incidence of artificial inoculation,resistance to Valsa Canker in six apple varieties planted in Yunnan were evaluated with Fuji as a control.The results indicated that those varieties showed different resistant to Valsa Canker.All of them showed more resistant to Valsa canker than Fuji.Yuhua Early Fuji and Siweita showed the highest resistant to Valsa canker following by Gala,spur Fuji,Royal gala and Golden century.With identification,make sure that those varieties can be used as resistant vaieties to Valsa canker in Yunanan.
  • Liu Xuehong, Zhang Liyan, Fan Yanhui, Zhang Lan, HAO Yali, Liu Nannan
    Abstract (602) PDF (947) RichHTML
    Phosphate-solubilizing bacterium(PSB) was isolated, screened and identified from the rhizospheric soil of Zhanhua winter jujube( Zizyphus jujuba Mill.) ,and phosphate-dissolving characteristics of PSB were determined.By using the way of clear zone,phosphate-solubilizing bacteria from the rhizospheric soil were preliminarily isolated,and the high effective PSB was further screened by using molybdenum-antimony anti-spectrophotometric method. The PSB was identified by the 16S rDNA sequence analysis combined with morphological characteristics.We carried out the salt-tolerant test,phosphate-solubilizing characteristics of PSB and optimization of fermentation medium in liquid tricalcium phosphate medium. The phosphate-dissolving characteristics of PSB in the soil were carried out under the greenhouse. The results indicated that one strain of high effective PSB was screened and identified as Rhizobium sp. The strain had significant effects on improving the solubilizing phosphate content in the liquid medium and the soil. This study provided excellent strain resource for improving phosphorus supply of Zhanhua winter jujube and promoting its growth.
  • ZONG Shu-ping, YANG Wen-xiang, LIU Da-qun, ZHANG Ting
    Abstract (601) PDF (447) RichHTML
    Baidu(16)
    The symptoms of the dongzao jujube black-spot disease which induced the fruit black spot affect the fruit commercial value and its quality.The disease is named according to its characteristics of the symptoms.The pathogens were investigated by using Koch's Rule in a two-years-test from 2004 to 2005.With samples from four jujube farms in Huanghua city and three fungi related to the disease were identified.They were,Coniothyrium fucsidulum Sacc,Phoma pomirum Thüm and Alternaria alternate(Fr.) Keissler.Coniothyrium fucsidulum Sacc and Phoma pomirum Thüm could infect the dongzao jujube fruits singly and jointly,but Alternaria alternata(Fr.) Keissler only coulde infect the dongzao jujube fruits jointly with other pathogens in the laboratory and field tests.
  • ZHANG Peng-fei, YU Dong-feng, LIU Ya-ling, SONG Mei-ling, ZHANG Ru, YONG Peng
    Abstract (600) PDF (485) RichHTML
    To know the genetic diversity and the genetic relationship of Ziziphus jujuba Mill. and Z.jujuba var.spinosa germplasm resources, 7 pairs of SSR molecular markers were used to analyze the genetic diversity of 16 Ziziphus jujuba Mill.and 17 Z.jujuba var. spinosa in this experiment.The results showed that 56 alleles were amplified in 16 jujbe samples, and number of effective alleles (Ne)ranged from 3.798 to 10.000 and averaged at 6.953, Shannon's information index (I) was 1.984, expected heterozygosity (He) was 0.837.Moreover, 73 alleles were amplified in 17 wild jujube samples, Ne ranged from 3.273 to 11.840 and averaged at 7.398, I was 2.105, He was 0.843.So, genetic diversity of both of jujube and wild jujube were rich, and the wild jujube level of genetic diversity was higher than that of jujube.And, the GenALEx analysis showed that gene flow between populations exchanged frequently, and population genetic differentiation percentage (Fst) of jujube and wild jujube was 0.055, the average value of gene flow among populations (Nm) was 4.295.Furthermore, NTSYSpc cluster analysis showed that jujube and wild jujube could be divided into three groups of jujube, wild jujube and transition group using SSR molecular markers.
  • LÜ Zhaoyong, ZHAO Chunmei, XUE Rengao
    Abstract (596) PDF (290) RichHTML
    Baidu(1)
    To study the expression of grape stress tolerance gene (CAN70200.1),a 1 354 bp promoter fragment (named as PCAN) upstream of the gene CAN70200.1 was isolated by using PCR technology.Promoter sequence was analyzed by the database of PlantCARE and PLACE.The result showed that the PCAN sequence contained basic elements CAAT-box,TATA-box and some cis-acting elements that response to abiotic stresses,light and plant hormones.To verify the expression pattern of the promoter,the PCAN fragment was fused with GUS reporter gene located on pCAMBIA1391Z to construct a plant expression vector p1391Z-CAN,followed by transformation into tobacco by Agrobacterium-meditated method.The expression activity of PCAN promoter reached highest at 120 min after drought stress treatment or at 30-60 min under 4℃ cold treatment condition,indicated that the PCAN promoter could express under the condition of treatments with cold and drought.
  • SHA Ting, HOU Hongmin, MENG Xiangna, BAI Suhua, ZHOU Aiqin, SHA Guangli, DAI Hongyi, ZHU Jun
    Abstract (595) PDF (186) RichHTML
    To obtain the transcription factor related to stress conditions in apple rootstock,an apple SBP gene with the full-length cDNA was cloned in Qingzhen 1(apomictic crabapple Pingyitiancha( Malus hupehensis Rehd.)× columnar apple strain CO(Malus × domestica Borkh.) and M26 via homology-based cloning method.The gene cloned was named as MdSBP20 .Bioinformatics analysis to the cDNA showed that the full-length cDNA was 1 362 bp,it's open reading frame possessed 1 362 bp,and encoded 454 amino acids,which had obviously SBP -domain and two zinc finger structures(Zn-1,Zn-2) and the bothway nuclear location signal(NLS).Phylogenetic analysis suggested that MdSBP20 gene had the closer relationship with Pyrus bretschneideri (XM_009339726.1)and Malus domestica (XM_008376435.1).Real-time PCR analysis showed that MdSBP20 gene played a role in response to low temperature,drought,and salt tolerance.It was inferred that QZ1 might has higher resistance than M26 no matter in stress of low temperature,drought,and salt.Based on the results in this experiment, MdSBP20 gene had the significantly effects in apple rootstock response to abiotic stress.
  • SHEN Zhi-jun, MA Rui-juan, YU Ming-liang, CAI Zhi-xiang, Song Hong-feng, LI Xiao
    Abstract (583) PDF (731) RichHTML
    Baidu(42)
    In order to discover the variation regularity of main sugar and organic acid during fruit development of peach, fruits of each developmental stage of 21 varieties were used to measure sucrose, glucose, fructose, sorbitol, malate, citrate and quinate wing HPLC. Similar regularities of sucrose were found in dfrferent varieties, as steady or small growth in early stage, continued with a sharp growth 30 to 50 d before fruit mature. Small decrease was happened in some varieties 10 d before harvest. Similar regularities ofcitrate were also found in dfrferent varieties, as high content in early stage, and a sharp decrease 10 to 30 d after flower, continued with contant low content, then a small growth, content of citrate decrease before harvest in most varieties. No distinct variation regularities were found in fructose, glucose, sorbitol, malate and quinate. During fruit developing, significant conelation between sucrose and fruit size, fructose and glucose were found in all 21 and 20 varieties, respectively. Flavors of matured fruit were significant positive conelated with sir crose, pH and sugar/ acid at 0.O1 level, and signfricantly positive conelated with total sugar at 0.O5 level. Flavors of matured fruit were signfricantly negative conelated with titratable acid, malate and total acid at 0.O1 level.
  • FENG Ruijie, HOU Lixia, GUO Yang, MA Qian, LIU Xin
    Abstract (582) PDF (148) RichHTML
    Using homology cloning method,the full-length cDNA of galactinol synthase gene VvGolS2, VvGolS3 and VvGolS4 were cloned from Vitis vinifera cultivar Zuoyouhong tissue culture seedling.The analysis of VvGolS2, VvGolS3 and VvGolS4 sequencing indicated that three genes were 954,978 and 1 011 bp ranging in size,coded as 317,325,336 amino acids respectively with molecular weight were 36.65,36.97,38.12 kDa and the isoelectric point were 5.12,5.33,5.16 respectively.Three VvGolSs all possessed a conserved hydrophobic APXAA pentapeptide domain in the C-terminal region.Real-time PCR analysis showed that three VvGolSs were expressed different in all tested tissues,with the highest expression of VvGolS2 and VvGolS4 in leaves,and VvGolS3 was highly expressed in flowers and tendrils. Using tissue culture seedling,the relative expression levels of VvGolS2, VvGolS3 and VvGolS4 after different stresses or different stress singling factors treatment were checked.The VvGolS2 and VvGolS4 were highly induced by salt stress,while the VvGolS3 was only induced by low temperature.Moreover, VvGolS2 was significantly induced by stress-related signal molecules,such as abscisic acid (ABA),ethylene (ACC),and hydrogen peroxide (H2O2).The VvGolS4 was induced by ACC,H2O2 and H2S,and the VvGolS3 was induced by ABA and ACC.Together,these results suggested that these three VvGolSs were involved in abiotic stresses resistance in grape with different functions.
  • XU Wei-hua, ZHENG Qiu-ling, LIU Wan-hao, SHA Yu-fen, FAN Shu-ting, TANG Mei-ling
    Abstract (573) PDF (142) RichHTML
    To study FT/TFL genes expression pattern in female and male floral of V itis amurensis Rupr.,three male and three female strains were used to study the expression of three FT/TFL genes ( VvFT,VvTFL1A and VvTFL1B) by Real-time PCR technology.The three genes expressed not only in female but also in male floral.The relative expression of VvFT gene in female were significantly higher than in male floral,while the relative expression of VvTFL1A and VvTFL1B genes in male flowers slightly higher than in female floral.The peak value of VvFT gene expression appeared at inflorescence show stage (May 14);while VvTFL1A and VvTFL1B expression appeared one peak value at bud intumescence stage (April 30).It was suggested that FT genes may be involved in regulation of early flowers,and TFL genes played a role in floral organ development.
  • ZHANG Yanzhen, LI Jianlong, LI Hui, CHEN Yizhao, HE Zhengyue, PAN Bin, LUO Bin
    Abstract (572) PDF (113) RichHTML
    In order to find the most appropriate way to prolong the shelf life under the condition of room temperature,this paper was to study combined short wave ultraviolet light(UV-C) irradiation treatment with different single or composite coating antistaling agent processing of peach fruit preservation effect.Using the phoenix honey peach in Jiangsu Zhangjiagang City as the experiment materials,with 20 W UV-C lamp for processing(irradiation dose:1 kJ/m2,irradiation distance:25 cm,irradiation time:3 min),after UV-C processing the peaches were grouped respectively for lysozyme,ascorbic acid,sodium alginate,and the three kinds of fresh-keeping agent composite coating processing,a total of 4 kinds of solution at room temperature(28±3)℃ conditions for preservation,span test for 14 d,every 2 d measuring related physiological and biochemical indexes.UV-C treatment combined with preservative coating could effectively reduce the phoenix honey peach rot,obviously delay the rising trend of malondialdehyde(MDA),polyphenol oxidase(PPO),and saved the fruit soluble solids content,single preservative treatment effect was not obvious difference; "UV-C+lysozyme+ascorbic acid+sodium alginate" was the best effect of peach fresh-keeping compound processing,decay index,the weightlessness rate and total soluble solids in 14 d were lower than the control group 73.02%,67.16% and 27.97%,respiratory peak by 4 d delay to 10 d,hardness,increased of MDA and the activity of PPO increased rate was lower than the control group 69.37%,45.06% and 19.65% respectively.UV-C treatment combined with ascorbic acid,sodium alginate and lysozyme processing method of the compound fresh-keeping agent could effectively reduce the phoenix honey peach under the condition of the real degree of rotting,delay the malondialdehyde(MDA) and the rise of polyphenol oxidase(PPO),significantly delayed respiratory peak,could be used as a new type of peach fruit under normal temperature preservation methods to promote the widespread utilization.
  • LIU Bingxu, YU Fengming, ZHANG Libin, WU Junkai, SONG Liqin, XIAO Xiao, DU Xiaodong
    Abstract (570) PDF (300) RichHTML
    In order to reveal the expression characteristic of genes (PAL1,PAL2,CAD,4CL,POD) related to lignin biosynthesis in brown pericarp mutant of Suisho pear,and provide the basis for further studying pear brown pericarp formation mechanism.RNA was extracted from different tissues according to RNA extraction kit (EASY spin,Biomed),primers were designed with Primer 5.0 and DNAMAN,expression pattern of genes were analyzed by QRT-PCR.Among the different tissues and organs,the highest relative expression of PAL1,PAL2,CAD,4CL,POD gene appeared in peels.In peels and pulps,the relative expression of POD gene was extremely significantly higher than the other genes.In flowers,leaves and branches phloem,the relative expression of CAD was extremely significantly higher than the other genes.The study suggested that the expression pattern of PAL,CAD,4CL and POD had significant tissue-specific in the five selected tissues and organs,and these genes may be associated with the formation of Suisho pear brown peel closely.
  • CHEN Di-xin, LI Yan-mei, GUO Guo-ning, CHI Hui, YANG Rui-juan, YANG Ying-jun
    Abstract (562) PDF (319) RichHTML
    The objective of the study was to obtain the 5' flanking sequence of polygalacturonase gene from the genomic DNA of Pruns persica (L.)Batsch.Chromosome walking techniques and the software of PROMOTER PREDICTION and PLANT CARE online were used.The results showed that a novel promoter of PG gene was obtained,the length of it was 986 bp,alignment indicated that the sequence had 96% homology with that of the polygalacturonase gene.The core promoter regions and some upstream regulatory elements in this fragment were analyzed.Transcriptional start site(TSS)was C.The sequence of PG gene promoter contained several specific acting elements,They were TATA-box,CAAT-box,light-responsive elements,drought-induced MYB binding sites,salicylic acid response elements,and other cis-elements.The accession number was FJ940722.The studying suggested that the expression of the novel promoter of PG gene could be regulated by hormone,drought,light and other factors.
  • WANG Hai-yan, LI Bao-hua, LI Gui-fang, WANG Cai-xia
    Abstract (551) PDF (254) RichHTML
    We developed an Agrobacterium- mediated transformation system for P.perniciosa by using the- conidia of strain LXS230101 as transformation recipients,A. tumefacien strain EHA105 carring plasmid pBIG3C har- boring the hygromycin B phosphotransferase gene (hph).Successful transformation of P.perniciosa was performord and the highest effiency reached on 686 transformants per 1 × 106spores.The optimal transformation conditions were that 1 × 106spores per milliliter of P.perniciosa- conidia suspension were co- cultured with Agrobacterium cells at 25 ℃ for 72 h,in the presence of Co- culture medium containing acetosyringone (AS) at 200 mol /mL.The trans- formants were verified by PCR amplification and by Southern blot analysis with the hph primers and probe,respec- tively.The results showed that all the detected transformants could be amplified the target bands and the T- DNA was inserted into the genome of P.perniciosa. In addition,the transformants were stable when grown on PDA medium without hygromycin for five times.
  • SI He-long, ZHAO Bin, ZHAO Fu-xin, XING Ji-hong, HAN Jian-min, DONG Jin-gao
    Abstract (550) PDF (249) RichHTML
    Baidu(1)
    One sclerotia-defect mutant of Botrytis cinerea BMH174 was obtained by Agrobacterium tumefaciensmediated method. The flanking sequence was acquired by TAIL-PCR, and then the T-DNA insertion gene confirmed by Blast in the B. cinerea gene database. The mutant gene was identified BC1G_06945. 1 gene by molecular biolo- gy. The sclerotia formation and pathogenicity in B. cinerea which will facilitate to understand molecular mechanism of conidium development, sclerotia formation and pathogenic in B. cinerea.
  • DENG Xiao-yun, DAI Hong-yi, LIANG Mei-xia
    Abstract (549) PDF (323) RichHTML
    Ent-kaurene synthase(KS) is a critical enzyme in the pathway ofgibberellins biosynthesis. In this research,ent-kaurene synthasegene in columnar apple,designated as MdKS,was isolated from apple(Malus domes-tica Borkh)stem apical tissue by homologous cloning technology. The full-length cDNA consisted of 2 214 nucleo-tides encoding a putative protein of 737 amino acids. MdKS contained a core functional domain DDXXD of plant class terpene synthase. Amino acids cluster analysis showed that KS from apple was highly homologous with PpKS firstly,had 98% similarity,and followed by that from Castanea sativa,had 73% similarity. The Real-time quantita-tive PCR analysis showed that MdKSgene were always expressed in columnar and standard apple trees during thegrowing season. In the earlygrowing season,the MdKS of standard apples were expressed at higher level than that of columnar apples,but on early June,it was opposite.
  • BAI Mu-dan, WANG Cai-hong, TIAN Yi-ke, CHEN Bao-yin, LIU Yun-long
    Abstract (547) PDF (322) RichHTML
    Baidu(1)
    GA 2-oxidase(GA2ox)is a critical enzyme in the pathway of gibberellins biosynthesis.In this research,GA2ox gene was isolated from Fuji stem apical tissue by homologous cloning technology.The cDNA sequence of GA2ox was 1 656 bp in length with 3 exons and 2 introns.Its open reading frame was 1 014 bp which encoding a protein of 337 amino acids.Molecular weight and isoelectric point of the protein was 37.679 8 kDa and 6.41,respectively.Conserved domains showed that the enzyme belonged to the class 2-oxoglutarate-dependent dioxygenases.Amino acids homology analysis indicated that the sequence had 51%-97% similarity with those of other reported plants.Cluster analysis showed that GA2ox from pear was clustered together with GA2ox from apple firstly,and followed by that from black cottonwood.
  • ZHANG Yong-fu, REN Zhen, CHEN Ze-bin, PENG Sheng-jing, NIU Yan-fen, DONG Cui-lian, CHEN Rui
    Abstract (545) PDF (458) RichHTML
    Baidu(2)
    In order to study the physiological mechanism of salicylic acid on alleviating aluminum toxicity of grape seedlings, solve the problem of aluminum toxicity in acid soil.Shuijing grape as material, using hydroponic method, in addition to the culture medium of 0.4 mmol/L aluminum chloride and different concentrations of salicylic acid were co-cultured for 5 weeks, after determination the indices of root, stem and leaf growth status, chlorophyll content, and active oxygen scavenging system and membrane lipid peroxidation of leaf and root.Effects of salicylic acid on the growth physiology of grape seedlings were analyzed under aluminum stress.The results show that under aluminum stress, plant growth was inhibited, leaf yellowing new leaves, root black.Chlorophyll content increased in old leaves and decreased in new leaves.SOD, POD and MDA contents increased in leaf and root and oxygen free radical production rate also increased, while root activity decreased.25, 50 μmol/L salicylic acid treatment significantly promoted the growth of grape seedling shoot stem, root color reddish, but 100 μmol/L salicylic acid treatment could inhibit the growth of grape seedlings, a small amount of root black.Salicylic acid treatment on the physiological effects of alleviate aluminum toxicity was obviously in grape seedlings.25, 50 μmol/L Salicylic acid treatment made chlorophyll and carotenoid contents were significantly higher than that of CK and single aluminum stress in old leaves, and the contents were significantly lower than single aluminum treatment.The SOD and POD activity in leaf and root were lower than single aluminum treatment, wheras the root POD activity was significantly higher.Production rate of oxygen free radical and malondialdehyde content treatment were lower than the single aluminum in leaf and root.In addition, 50 μmol/L salicylic acid treatment also significantly increased root vigor under aluminum stress.Thus, aluminum stress inhibition on the growth of grape plant significantly, showed strong poison, while salicylic acid treatment, had a certain effect on the remission of grape aluminum toxicity, among which 50 μmol/L salicylic acid treatment to the most obvious physiological effects alleviated aluminum toxicity in grape seedlings.
  • LIU Li, SUN Hong-li, CHENG Zhao-yang, JIA Bing, LIU Pu, YE Zhen-feng, ZHU Li-wu, HENG Wei
    Abstract (541) PDF (450) RichHTML
    To study the formation mechanism of the russet mutant of Dangshansuli, the enzyme genes related to the lignin biosynthesis, PAL2,4CL1,CAD1,PPO1,POD4 were cloned and the relative expressions of different genes in the pericarp of Dangshansuli and its russet mutant were analyzed with real -time PCR at 25, 50, 75, 100, 125, 150 and 175 days after full bloom ( DAFB).The results showed that the relative expressions of PAL2,4CL1,CAD1, POD4 and PPO1 genes in pericarp of Xiusu pear were all higher than that of Dangshansuli pear at 25, 50, 75, 100, 125,150 and 175 DAFB.The correlation analysis between the lignin increment and the relative expressions of POD4 enzyme gene exhibited extremely significant differences in the pericarp of Dangshansuli, while that of PAL2, 4 CL1, CAD1 and POD4 enzyme gene in the pericarp of Xiusu.It is believed that PAL2,4CL1,CAD1 and POD4 enzyme genes in biosynthesis of lignin involved in the formation of Xiusu russet skin.
  • HAO Jie, WEI Liang, WANG Xian-ge, LI Xue-ying, SUO Xiang-min, YAN Xin-min, FENG Jian-zhong
    Abstract (533) PDF (237) RichHTML
    The objective of this study is to determine the dynamic changes of the major elements in soil between young Guohong apple trees and adult ones.The soil of young and adult Guohong apple trees had been collected in Shijiazhuang Pomology Institute,Hebei Academy of Agriculture and Forestry Sciences,and the content of the five kinds of major elements had been tested by VISTA-MPX plasma spectrometer,and multivariate statistical analysis and correlation analysis had been done by SPSS software.The result showed that during the whole growth period the content of Boron waved between the young trees and adult ones,while the content of Iron,Zinc had no changes significantly.Typical correlation analysis showed that the content of Manganese were significantly positive correlation between elements in 0-20 cm soil layer,Zinc too.while the content of Zinc were significantly positive correlation between elements in 20-40 cm soil layer,Boron too.The five microelements had no correlation in 40-60 cm soil layer.The results provided scientific theoretical basis for guiding the orchard how to cultivate for higher qualities,and for studying how to enhance the content of the microelement by different cultivation measures.
  • TAN Bin, WANG Ting, HAO Pengbo, ZHENG Xianbo, CHENG Jun, WANG Wei, FENG Jiancan
    Abstract (531) PDF (135) RichHTML
    To investigate the effects of exogenous GA3 and PBZ treatments on the growth of shoots and the expression of genes related to gibberellin biosynthesis and gibberellin signal transduction pathway in Huangshuimi, the annual shoots of Huangshuimi were treated with exogenous GA3 and PBZ. The growth of shoots was measured and the expression levels of eight GA-related genes were determined by qRT-PCR. The results showed that the net length of shoots at 8 d was significantly higher in GA3 treatment than in CK. The expressions of KO and GA3-ox showed a trend of firstly increasing and then decreasing in the early stage after treatment, while gradually rising in the later stages. The expression of DELLA, GID1c and SLY1 genes related to GA signal transduction was inhibited at the early stage and then rapidly increased in the late growth period after treatment. And the expression of the three genes was up to maximum in 14 d after treatment. For the PBZ treatment, the net length of shoots was lower than the CK at many stages, and reached to a significant level at 17 d after treatment. The expression of genes related to gibberellin biosynthesis KO, GA20-ox and GA2-ox showed the trend of increasing gradually and then decreased. While GA3-ox showed almost no expression in whole treatment period. The expression of DELLA, GID1c, SLY1 and ERF11 related to gibberellin signal transduction pathway were slightly lower than the CK during the whole process. It was speculated that the exogenous PBZ might regulate the plant growth at the transcriptional level by inhibiting the synthesis of active gibberellin and further affecting the expression of genes involved in the gibberellin signal transduction pathway. Meanwhile, the reverse treatment of GA3 could significantly abolish the inhibitory effect of PBZ on plant growth, and the expression of GID1c gene involved in gibberellin signal transduction pathway increased firstly and then decreased under GA3 treatment, while the expression of DELLA gene appeared to be inhibited in most of the time.
  • WEN Peng-fei, WANG Xue-ting, NIU Tie-quan, GAO Mei-ying, NIU Xing-yan, XING Yan-fu
    Abstract (530) PDF (211) RichHTML
    In this papeR, the wine gRape beRRy( Vitis vinifeRa L. cv. CabeRnet Sauvignon) weRe used as mateRials, and the effect of haRvesting pRolongation on the plasma membRane peRmeability was studied. The Results showed that both plasma membRane peRmeability and the concentRation of malondialdehyde,pRoline and hydRogen peRoxide in the gRape beRRy weRe incReased. The plasma membRane peRmeability, the concentRation of malondialdehyde( MDA) , pRoline and hydRogen peRoxide( H2O2 ) weRe incReased by 37. 2%, 35. 1%, 405. 7% and 41. 5%. But theRe was no significant diffeRence in plasma membRane peRmeability fRom Sep. 21st to Oct. 21st, and in the concentRation of MDA and H2O2 in the whole peRiod, and theRe was significant diffeRence in the concentRation of pRoline fRom Oct 1st to Oct 21st.
  • MA Hui-li, LÜ De-guo
    Abstract (529) PDF (204) RichHTML
    Baidu(4)
    The photosynthetic characters of Hanfu apple leaves under different light conditions were studied by analyzing the gas exchange and chlorophyll fluorescence parameters.The result showed that the net photosynthetic rate(Pn),stomatal conductance(Gs),intercellular corbon dioxide concentration(Ci),maximal photochemical efficiency(Fv/Fm) and photosynthetic performance index(PI) all decreased gradually in dought condition,and reached the lowest in extreme drought,but recovered slowly after rehydration.At the end of the treatment,Pn of leaves under the full light and shading conditions was respectively 41.4% and 38.1% lower than that before the treatment.Along with the drought stress and drought relief,the density of SPⅡ reaction per excited cross section(RC/CSo),the energy absorbed per unit area(ABS/CSo) and the heat dissipation of energy(DIo/CSo) increased gradually,and started to decline after they reached the highest.The differences of leaf ABS/CSo and DIo/CSo among different lighting conditions reached a significant level after 7-days of drought stress,which was probably related to the quality of leaves.
  • WANG Guodong, CHEN Chaoyin, LI Jinjing, PU Limei, GUAN Ruipan, GE Feng, LIU Diqiu
    Abstract (529) PDF (191) RichHTML
    To investigate the function of JsWRKY1, a constitutive expression vector of JsWRKY1 was constructed and transferred into Nicotiana tabacum L.cv Xanthi.There were no visible differences between the positive transgenic plants and WT.The expression levels of several defense-related genes MnSOD, Cu/ZnSOD, CN, NADPH oxidase, and PR1 resistance gene were up-regulated in the transgenic tobacco lines,and the SOD,APX and POD showed significantly higher activities in the transgenic lines than in wild type under normal conditions or after inoculation with C.gloeosporioides. The crude protein extract of transgenic tobacco lines inhibited the hyphal growth of the following four fungi, Botrosphaeria dothidea, Gibberella moniliformis, C.gloeosporioides and Fusarium oxysporum at different degrees.The antifungal activity in vitro plates demonstrated that the activities of SOD in the transgenic tobacco lines were significantly higher than those in WT.Moreover,the transgenic tobacco plants showed strong resistance after inoculation with C.gloeosporioides in the leaves.In conclusion,the JsWRKY1 is a positive transcription factor of J.sigiuata regulating the defense response to pathogens.
  • SUN Ye-hong, ZHANG Yuan, LI Zhong-yong, SHAO Jian-zhu, XU Ji-zhong
    Abstract (528) PDF (352) RichHTML
    Baidu(1)
    The study was conducted to screen molecular markers of salt-tolerance gene in apple rootstock, which providing a theoretical basis for molecular assistant selection breeding in plants salt-tolerance.F1 of Malus micromalus ×S19 were used to screen markers linked to salt-tolerance gene by BSA method and SRAP technology.Four pairs of primers (Me1Em2, Me1Em8, Me6Em12 and Me6Em14) were screened from 128 ones, which expressed polymorphism in parents and DNA pools and totally produced 4 polymorphic fragments.The four pairs of primers were tested by 144 F1 hybrid seedings, and the coincidence rate between hydroponic screening and the SRAP analysis were between 81.94% and 92.36%.The length of the 4 polymorphic fragments (Ⅰ, Ⅱ, Ⅲ and Ⅳ)was between 139 bp and 233 bp by cloning and sequencing.Sequence alignment revealed that sequenceⅠhad relatively highly identity with ATP synthase beta subunit gene(ATP-β) from Photinia fraseri, and there was an identity of 98% for nucleotide sequence.Additionally, other sequences showed partial identity with probable receptor-like protein kinase from Pyrus × Bretschneideri, myosin from Malus domestica, and UDP-glycosyltransferase from Malus domestica, respectively.The 4 markers selected not only could be used in molecular identification of salt tolerance, but also provide a foundation to clone salt-tolerance gene for apple rootstock.
  • GUO Jin-li, ZHANG Xiang-wen, ZHANG Shu-yuan, NA Guang-yu
    Abstract (522) PDF (366) RichHTML
    The nutrition of leaves and soils with different fertilizer norm and different tree vigour in full fruit period of Jinhong apple(GM256intermediate stock)were studied in order to realize nutrition condition and fertilizing.Results showed:the nutrition of leaves with different fert ilizer norm and different tree vigour were both N content moderate,P and K content insufficient,N,P,K content nutritional disorder;Ca,Mg,Fe,Zn,Cu,B content moderate or enough,Mo content insufficient.The results suggested that the fertilizer ratio of N,P,K content was 2 1.5 1.5-2.
  • PENG Yu, XUE Da-yuan, LI Xi-meng, WANG Yan-jie, MA Shuai, FENG Jin-zhao
    Abstract (521) PDF (458) RichHTML
    Soil salinization and alkalization is a worldwide problem limit productivity of horticultural crops.Many studies have focused on responses of crop to either salt or alkaline stress. However, seldom have studies focused on the effects of this mixed stress. In our experiment in Yinchuan, Northern China, the mixtures of three salts( NaCl, Na2SO4, Na2CO3 with proportion of 1 ∶ 0. 5 ∶ 0. 5) in various concentrations (0, 100, 200, 400 mmol /L) wereused to simulate a range of soil natural salt-alkaline conditions. Three-year-old seedlings of two grape cultivars,Crimson ( CRS) and Moldova ( MDW) , widely spread in the world, were planted in open field conditions under thetreatments. The results indicate that light saline-alkaline treatments enhanced the photosynthetic capability in twogrape cultivars. For the high concentration, net photosynthetic rate ( Pn) and stomatal conductance ( Gs) of CRS orMDW increased. In Pn light response curves, the same tendency was observed. For CRS, the increase of Pn benefitedfrom high Gs and transpiration rate ( Tr) , however, a low Fv /Fm decreased such impacts. For MDW, high Fv /Fmhelpfully maintain a relatively stable Pn. The two cultivars demonstrated different suitability regime to saline-alkalinestress.
  • ZHAO Deying, YUAN Jicun, XU Kai, CHENG Cungang, YAN Shuai
    Abstract (521) PDF (574) RichHTML
    In this study,we aimed to identify the differences of tree morphology,accumulation and distribution characteristics of mineral nutrient in root system of Gala apple young tree with different dwarfing interstocks.The results were expected to reveal the relations between the tree dwarfing ability and accumulation,distribution of mineral nutrient in root system.Gala apple saplings (in pots) grafted onto dwarfing interstocks (GM256,Liaozhen No.2,SH1,SH6,SH38,and SH40) with uniform growth vigour were used as the experimental material.After spring shoot growth stopped,plant height and cross-sectional area were measured.The root morphology indexes were analyzed by WINRhizo analysis software.For the measurement of mineral nutrient contents,healthy plants at the same growth stage were removed from the pots,and were dissected and separated into different diameter root system.The contents and accumulations of mineral nutrient were determined.The results showed that plant height and cross-sectional area of Gala apple trees grafted onto dwarfing interstocks were obviously lower than that of the control.The degree of dwarfing of the interstocks followed the order of SH38 > SH1 > SH6 > GM256 > SH40 > Liaozhen No.2.Differences in mineral nutrient contents in different diameter root system of Gala apple young tree among different dwarfing interstocks were obviously different.The mineral nutrient contents in<0.5 mm diameter root system were highest,and the mineral nutrient contents decreased with the increase of root system diameter.The contents of K and Mg of Gala apple root system for SH38 were highest.Root system for SH1 interstocks had the highest Cu,Fe and Zn contents.The accumulations of P,Ca,Fe in all parts of GM256 interstocks root system and that of K,Mg and Zn in>3 mm diameter root system were higher than control and other treatments.The accumulations of K,Mg and Zn in<3 mm diameter root system for Liaozhen No.2 were highest.The mineral nutrient accumulations of SH38,SH1 and SH6 with weak growth vigour were lower than that of Liaozhen No.2,GM256 and CK with strong growth vigour.The optimal interstocks for Gala apple with better dwarfing effect were SH38,SH1 and SH6.In practical application,site condition,soil supplying nutrient capability and nutrient requirement characteristics of different stock-scion combinations should be fully considered,which for realizing the high quality and high efficiency production of apple.
  • WANG Juan, TAO Yong-huan, SONG Shang-wei
    Abstract (520) PDF (324) RichHTML
    To develop the new EST-SSR marks from the EST-SSR database of grape germplasm, the statistic software of SSRs were utilized to search the sequences of EST containing SSRs, then the available were selected and the corresponding primers were designed and filtered. All the obtained 16 pairs of pleomorphic primers were used to carry out PCR amplification for 62 grape materials. Using UPGMA method to construct dendrogram based on the similarity coefficient calculated by the software of NTSYS. To invstigate the genetic relationships of grape germplasm resources and farther validate the feasibility of EST-SSR on classifying grape germplasm resources, the clustered re- sult was analyzed. The result indicated that the similarity coefficient of majority germplasm was more than 0. 74, and 62 grape materials were classified into 4 groups at 0. 658. Most grape germplasm resources having close kinship were clustered together, and the similarity coefficient of intraspecies was bigger than interspecies. The result was consist- ent with that acquired from traditional taxonomy.
  • CUI Tengfei, WANG Chen, TAN Hongyu, JIA Haifeng, BAI Yunhe, WANG Wenran, FANG Jinggui
    To explore the potential role of Resveratrol synthase(Rs) in fruit development of Vitis vinifera cv. Kyoho, the structure and function of Rs sequence were analyzed, and the spatio-temporal expression specificity at different developmental stages of fruit was identified. The bioinformatics analysis and qRT-PCR method were used to analyze the sequence of Rs gene in Kyoho grape. The structure and subcellular localization of Rs gene were predicted, and its expression in different tissues of fruit at different developing stages was analyzed. The full-length cDNA of Rs gene was 1 539 bp, with an open reading frame(ORF) of 1 179 bp, encoding 392 amino acids. The predicted molecular weight was 42.88 ku, and the theoretical pI was 6.09. The gene contained chalcone, stilbene synthase activity sites and complete stilbene synthase family characteristic sites. The protein interaction predicted that Rs interacts with OMT2.1, which catalyzes resveratrol biosynthesis of Pterotilbene. The results of subcellular prediction showed that the Rs gene mainly expressed in the cytoplasm and chloroplast. The promoter analysis showed that the expression of Rs gene might be regulated by light, MYB, fungi and hormones, presenting a certain tissue specificity. qRT-PCR analysis showed that the Rs gene of grape expressed at different stages of the peel and flesh, but the expression level was highest in the 25th day after anthesis. Combined with the role of Rs gene accumulation in resveratrol, it could be inferred that there might be a high accumulation of resveratrol in the fruit peel during the early period of fruit development. The Rs gene of Kyoho grape had a high conservation during evolution, and its expression might be regulated by environment, fungi and hormone. It had the interaction with OMT2.1 and had a certain specificity in different tissues and development periods.
  • ZHANG Xue-mei, LI Bao-guo, QIN Li-zhe, QI Guo-hui, GUO Su-ping
    Abstract (514) PDF (194) RichHTML
    Baidu(5)
    In order to discuss the mechanism of apple self-compatibility,the primer P1:5-'TTTACGCAGC AATATCAG-3'and P2:5-'ACGTTCGGCCAAATA/CATT-3'of apple style S gene were designed according to the conservative amino acid sequence,the primer P SLF1(upriver 5-'3':CTGGTGGTGTTCTTTCCTGTGTAT;backward position 5-'3':ACTTAACTCTTCCCTCAACTCA) and P SLF9 (upriver 5-'3 'CAGGTGCGTGAAAGTGAAA;backward position 5-'3 ':TGAGCCAAGCATAAGAACCT) of apple pollen S gene were designed according to the SLF1 (DQ422810) and SLF9 (AB270792) in GeneBank,the molecular character of self-compatible apple Zaohongxiang was studied in the method of PCR-RFLP,clone and sequence.The result showed that:tow style S gene of self-compatible apple Zaohongxiang did not variation.DNA sequence of pollen S gene which was amplified through pollen S gene primer P SLF1 and P SLF9 compared with the sequence of MdSLF2 and MdSLF9 had a high similarity,which arrived at 94% and 96%,amino acid similarity was 94% and 97%.The similarity of Pollen S gene SLF1? which was amplified through P SLF1 and DNA sequence of MdSLF1 was 83%,and the differ bases were distributed in the whole DNA sequence,so that pollen S gene SLF? could changed into MdSLF2.
  • YANG Yan-rong, ZHAO Jin, LIU Meng-jun
    Abstract (512) PDF (1082) RichHTML
    Baidu(21)
    Bearing branch is the basic fruiting units of Chinese jujube.Understanding the biological characteristics and growth of bearing branch is important to improve quality and yield of jujube fruits.Therefore,the concept,the biological characteristics,the sorts and the growthing of bearing branch were summarized.And the relation of bearing branch and fruiting was also reviewed.At last,the main problems which need to study furtherly were also outlined.
  • MA Wen-hui, SUN Li-yi, YU Li-guo, WANG Jing-tao, CHEN Jiang-yu
    Abstract (507) PDF (712) RichHTML
    The occurrence and life history in Aromia bungii(Faldermann) were observed.The results showed that A.bungii occurrenced once on every 4 years in Shijiazhuang,Hebei Province.The imago occurrenced in the end of June or the bengining of August.The ratio of the female and the male was 1∶1.31.Eggs hatching began in the bengining of July,reached the peak at the end of July or the beginning of August,and finished in the middle of August.The hatching larave began to damaged in the middle or the end of Sepetember,and overwintered in the tunnels of trunks in the end of December.From the middle of March to the end of June or the begining of July in the seconed years,the overwintering period began to be over.Then the larave in the trunk xylme began to damage again,and reached overwintering in the beginning or the middle of sepetember or the beginning of October.The larave damaged once more in the begining of April of the third year, and stopped damaging in the begining or the middle of June.Until the begining or the middle of May in the forth year the larave began to pupate.The resting stage was 290.7 d averagely.The larave pupated in the pupal chamb for 17.3 d averagely,then came out.
  • RAN Ce, CHEN Liu, LU Jia-lan, LIU Zheng-ping, WEI Yan-min, ZHAO Xiao-yan, SHANG Qiao-xia
    Abstract (499) PDF (594) RichHTML
    Different DNA isolation methods were used in researches due to the diversity of secondary metabolites in different plant tissues.The existing of large amounts of polysaccharides,proteins,polyphenols and pigments in strawberry plants influenced the extraction of high quality DNA from strawberry leaves and afterwards PCR reaction.In order to identify the DNA extraction method which was applied to the PCR detection for Strawberry vein banding virus (SVBV),total DNAs extracted from strawberry leaves by three different extraction methods to detect SVBV by PCR were tested and compared in this study.Strawberry leaves infected by SVBV were used as the materials from which CTAB kit method,high salt and low pH method (HSLPM) and modified SDS method were used to extract DNA in this paper.The quality and quantity of DNA extracted by these three different methods were analyzed by gel electrophoresis and UV spectrophotometers.SVBV was detected by PCR from extracted DNA to determine the effect of different DNA extraction methods on the stability of PCR detection.The results showed that all the three methods could isolate complete DNA fragments.Sequencing and sequence analysis of the PCR products from strawberry leaves infected by SVBV proved the reliability of the methods.DNA extracted by three methods from strawberry leaves could be detected the infection of SVBV showed the quality of DNA extracted by all the three methods could meet the specific demands of PCR detection of SVBV in strawberry leaves.Compared with the other two extraction methods,results showed the quality of DNA extracted by CTAB kit was the best in these three different DNA extraction methods in this paper.
  • ZHOU Xing-ben, LIU Shi-chong, GUO Xiu-wu, WANG Cong-cong, LI Kun, GUO Yin-shan, LI Cheng-xiang
    Abstract (497) PDF (293) RichHTML
    In order to ascertain the relationship between photosynthetic characteristics and soil water content of grape in different growth periods.Centennial seedless grape was used to study the photosynthetic and fluorescence characteristics at three different water treatment levels(The soil moisture treatmentⅠ is 50%,treatmentⅡ is 65%,treatmentⅢ is 80%)The results showed that:The photosynthetic rate and irrigation is positively correlated at new shoot growth period,fruit setting period and veraison.The photosynthetic rate of the treatment Ⅱof medium irrigation amount is the highest in after picked.The water use efficiency of different period is not the same,water use efficiency and irrigation quantity was negatively correlated in new shoot growth period and after picked while fruit setting period and veraison is contrary.With the overall,the fluorescence parameters changes of Centennial seedless in different growth periods under different water conditions were positively related to irrigation amount.The comprehensive photosynthetic performance(PI)and photosynthetic parameters changes are similar.PI in the first three periods(New shoot growth period,fruit setting period and veraison) showed positive correlation with moisture;the treatment Ⅱof photosynthetic performance is the best after picked.Comprehensive indexes of the results were as follows:the irrigation of treatment Ⅲ is suitable for Centennial seedless in shoot growth period;the irrigation of treatmentⅡ is suitable for centennial seedless in fruit setting period,veraison and after picked.
  • LIU Mingchi, KOJIMA Takayuki, TANAKA Munehiro, CHEN Hang
    Abstract (494) PDF (982) RichHTML
    With the decreasing of fruit water content,the fresh size and titratable acidity decrease and fruit hardness,soluble solid-acid ratio,soluble sugar content and color indexes increased.The effect of fruit water content on sucrose,glucose and fructose was different.Fruit water content has a significant correlation with soluble solid content (r=-0171)and soluble solid-acid ratio(r=-0161).
  • KU Yongli, XU Guoyi, ZHAO Hua, CAO Cuiling
    Abstract (494) PDF (194) RichHTML
    In order to solve the serious problem caused by excessive fertilization and continuous cropping obstacles that soil nutritional indexes of elderly kiwifruit orchard gradually worsen in Meixian,Shaanxi,the influence of applying three different microbial fertilizers mixed with humic acid on dynamic of soil nutrients system in growth periods of kiwifruit(germination,florescence,fruit enlargement,fructescence and next germination period)and fruit quality were studied through field experiment by using traditional fertilization as control(CK). The result showed that three kinds of compound microbial fertilizers could significantly increase the number of bacteria,actinomycetes and yeasts in kiwifruit rhizosphere,and reduce the number of fungi,so as to improve and balance the soil microbial community structure;These treatments could significantly increase soil enzyme activity of kiwifruit(especially JKY,whose effect was most remarkable,its sucrase was 48.65%-255.51% higher than that of CK in different periods,phosphatase was 30.23%-60.23% higher than that of CK,polyphenol oxidase was 106.22%-182.04% higher than CK,protease increased 13.74%-126.12% compared with CK,and urease was 21.17%-177.41%),enhance soil fertility(nitrate and ammonium nitrogen,available phosphorus and potassium,total nitrogen,total phosphorus,total potassium and organic matter content increased significantly),and decrease soil pH(the soil pH in the JKY group decreased by 0.25-0.48 units compared with the control).Compound microbial fertilizers could increase fruit firmness and vitamin C,soluble sugar content of kiwifruit,and reduced the content of titratable acid. Comprehensive analysis showed that the three kinds of compound microbial fertilizer could improve elderly kiwifruit orchard soil,improve the quality of the kiwi fruit.
  • LiuGuisen, ZhangLibin
    Abstract (493) PDF (264) RichHTML
    The change of catalase activity of leaves in various years and the change of the enzyme activity in the growing period for varieties of apple were studied. The results showed that there were significant differences both in the varieties and among years. The catalase activity was the highest in Starking Doyle, Grimes and Golden. At the first growing peak of shoots and fruits, the activity was the highest. Along with the decrease of the growing speed of shoots and fruits and the increase of leaf growing,the activity showed a dropping tendency, but the change of its activity related unsignificantly to the environment conditions (temperature and humidity).The change of the activity in the growing periods of these varieties was very identical. There was a significant negative correlation between catalase activity and the percentage of setting fruit before physiological fruit drop (r = - 0.8024). It was considered that the persentage of setting fruit in varieties or trees was related to the catalase activity.
  • ZHANG Yonglin, GAO Bin, ZHOU Jie, ZHU Shuhua
    In order to study the regulation mechanism of 2-Cys Prx gene to redox signal molecules. 2-Cys Prx of Feicheng peach was studied by gene cloning and prokaryotic expression including PCR technique and RT-PCR technique. The experimental results showed that the full length of 2-Cys Prx gene was 1 424 bp induced 813 bp of coding sequence encoding a polypeptide of 270 amino acids,with predicted molecular weight of 29.7 ku. The predicted protein molecular formula of 2-Cys Prx was C1342H2110N348O403S4 with a molecular weight of 29.696 ku,which contained 4 207 atoms. For 2-Cys Prx,the theoretical isoelectric point was about 6.23,and the total average hydrophobicity index was -0.126,which indicated that 2-Cys Prx protein was a hydrophilic protein. The two level prediction of 2-Cys Prx protein composed of 9 segment of fold and 4 segment of alpha helix and the irregular. Phylogenetic tree analysis showed that the 2-Cys Prx was most closely related to Prunus avium,with 98.15% amino acid homology rate. The high homology of amino acids of 2-Cys Prx in peach fruit and other plants,indicating that 2-Cys Prx was more conservative. These results would lay a foundation for researching the structure and function of 2-Cys Prx protein to explore the mechanism of 2-Cys Prx regulation of redox signal molecules in the further study.
  • CAI Bin, LI Cheng-hui, PENG Ri-he, XIONG Ai-sheng, GAO Feng, YAO Quan-hong, ZHANG Zhen
    Abstract (491) PDF (318) RichHTML
    microRNAs ( miRNAs) represent a new family of non-protein-coding small RNAs ( 20- 25nt ) that functionby degrading targeted mRNAs or repressing mRNA translation. Here we developed a program-MirFinder for predictionof grape miRNAs.The characteristic features of known plant miRNAs were used as criteria to search for miRNAs. Aftersearching the grape genome, MirFinder ident ified 146 miRNAs, of which 98 miRNAs were the same as known miRNAsand 48 are new ident ified miRNAs.The 48 miRNAs were classified into 21 families, of which 8 families are newly identified in grape. A total of 15 potential targets were identified for 6 of the 8 new miRNA families based on the fact that miRNAs exhibit perfect or nearly perfect complementarity with their target sequences
  • WANG Min, DONG Li-ping, ZHAO Bin, ZHENG Xu, SI He-long, ZHANG Jing, SHI Cui-ping, XING Ji-hong, DONG Jin-gao
    Abstract (491) PDF (619) RichHTML
    The objective of this study was to obtain pathogenicity-related genes of Botrytis cinerea and to investigate the function of pathogenicity-related genes.An enhanced pathogenicity mutant,named BCt98,was found by screening T-DNA insertional mutant library of Botrytis cinerea and it was testified by PCR and Southern Blotting techniques.T-DNA insertion site was defined in the third exon of BC1G_07014.1 gene by using TAIL-PCR and bioinformatics methods.The mutant gene was identified as BC1G_07014.1 by RT-PCR technology.Compared to the wild type strain,the mutant BCt98 growed quickly,colony was white,did not produce conidium and sclerotia,but showed stronger on cell wall degrading enzyme activity and toxin activity.These results showed that the BC1G_07014.1 gene was involved in growth,development,pathogenicity and involved in regulating cell wall degradation enzyme activity and toxin activity in B.cinerea.