Special Issue

Apple
This special topic selects papers related to apple published in Acta Agriculurae Boreali-Sinica , involving papers on apple genetics and breeding, cultivation, physiology and biochemistry, soil fertilizers, diseases and pests, etc.Click on the relevant paper to open the web page and download the full text. In order to quote and share for readers, each article contains a complete citation format in Chinese and English (including international DOI number) and a proprietary  QR code. Long press the  QR code of the article to open the web page of the article and realize mobile sharing at the same time. Thank you for downloading, quoting, forwarding and sharing.
Sort by Default Latest Most read  
Please wait a minute...
  • Select all
    |
  • DONG Yue-ju, ZHANG Yu-gang, LIANG Mei-xia, DAI Hong-yi
    Abstract (809) PDF (623) RichHTML
    Baidu(19)
    For ascertaining the main evaluation factors of apple fruit,Nine quality index were measured of fifty-eight varieties.The index included mean individual fruit weight(MIFW),fruit shape index(FSI),flesh rigidity(FR),total soluble solids content(TSS),titratable acid content(TA),pH,vitamin C content,carotenoids,the ratio of sugar acid(RSA).These data were analyzed by variation,correlation analysis principal component analysis and system cluster analysis.58 varieties of fruit quality were analyzed by variation correlation,nine index were compressed into six integrated variables using principal component analysis.Final main evaluation indicators of apple fruit were determined by using cluster analysis and correlation analysis.The results indicated that the range of variation coefficient was from 5.7% to 77.8%.Mean individual fruit weight,flesh rigidity,vitamin C,carotenoids were the important components of fruit quality,playing a major role on fruit quality.These nine index were closely related and the relatively independent.Vitamin C was significantly and negatively correlated with titratable acid content and was significantly and positively related to mean individual fruit weight.Carotenoids was significantly and negatively correlated with titratable acid content and was significantly and positively related to the ratio of sugar acid.Based on the above results,five representative index were assured for evaluating fruit quality,that is fruit weight,fruit shape index,flesh firmness,contents of total soluble solids,and content of titratable acid,which could reflect the most information of apple fruit quality.
  • ZENG Guang-juan, LI Chun-min, ZHANG Xin-zhong, CHEN Dong-mei, ZHAO Yong-bo, DONGWen-xuan
    Abstract (700) PDF (1034) RichHTML
    Baidu(17)
    In order to develop an efficient protein extraction method suitable for SDS - PAGE analysis,five protocols for protein extraction in apple leaf,trichloroacetic acid/acetone precipitation (TCA),modified Tris - HCl extraction,phenol extraction methanol/ ammonium acetate precipitation,DTT/ acetone and Tris - HCl extraction were compared.The extracts were separated by SDS - PAGE method followed by silver staining. The results showed that the modified Tris-HCl extraction presented the highest resolution of 3. 243μg/μL and the maximum bands of 41 strips with the 5μL sample volumes basing on the increased amount of PVPP and the extracting solution as well as prolonged 30 min of protein precipitation with cold acetone.Dynamic changes of proteins in leaves from different nodes in apple seedlings (Jonathan ×Golden Delicious)were analyzed with the improved Tris - HCl extraction method,six protein bands were detected with the molecular weight 71.9,60.5,52.6,41.1,35.3,18.5 kDa respectively and the bands were clear with a light background.So the improved Tris - HCl extraction was the most appropriate method for apple leaf SDS - PAGE analysis。
  • ZHANG Guojun, WANG Tingting, HU Lizong, LI Shufen, GAO Wujun
    Abstract (697) PDF (205) RichHTML
    To extensively understand the sequence feature and evolution of heat shock transcription factors (Hsf)in the genome of apple,fifty MdHsf genes were identified using bioinformatics methods at the whole-genome level of apple,and a series of analysis including sequence characterization,phylogenetic relationship,gene expression and selective pressure of MdHsf genes were further performed.Phylogenetic relationship and sequence characterization analysis showed that,like the model species Arabidopsis and rice,50 MdHsf genes were divided into three subfamilies A,B and C.Additionally,at least two genes were found in the same end clades in the phylogenetic tree,indicating that the lineage-specific amplification had happened during evolutionary processes of apple Hsf gene family.Although the intron numbers and sizes of MdHsf genes were relatively divergent,the conserved motifs and domains of MdHsf proteins were highly conserved because of functional constraints.Based on EST data,72% of the 50 genes (except 14 genes such as MdHsfA2a and MdHsfA3a/b/c)had transcription activities.Selective pressure signatures demonstrated that no positive selection site was identified in the cleaned codon alignments for 36 MdHsf genes based on site-specific model,suggesting that this protein family was controlled by purifying selection.However,branch-site model had identified a total of five positively selected sites in the d and e clade of the phylogenetic tree,i.e.28R,30L,35D,51M and 67V.28R and 30L were included in the Hsf domains,while 35D,51M and 67V were not mapped on the region of Hsf domains,suggesting that purifying selection was the main evolutionary dynamics of functional conservation Hsf domains except for 28R and 30L.In conclusion,various Hsfs existed in apple genome,and the conserved motifs and functional domains were conserved.The majority of them had transcription activity,and the evolution of this family was dominated by purifying selection.
  • GUI Teng-rong, JI Pan, KONG Bao-hua, ZHANG Yan-ming, MA Yu-mei, CAO Ke-qiang, MA Jun, HUANG Wen-jing, YUAN Yuan, MA Xue-lin
    Abstract (602) PDF (272) RichHTML
    For importing new apple varieties into Yunnan and adjust apple variety structures,new apple varieties imported were need identified their resistance to Valsa Canker.Combining analysis of the investigation of natural infection incidence in orchards and incidence of artificial inoculation,resistance to Valsa Canker in six apple varieties planted in Yunnan were evaluated with Fuji as a control.The results indicated that those varieties showed different resistant to Valsa Canker.All of them showed more resistant to Valsa canker than Fuji.Yuhua Early Fuji and Siweita showed the highest resistant to Valsa canker following by Gala,spur Fuji,Royal gala and Golden century.With identification,make sure that those varieties can be used as resistant vaieties to Valsa canker in Yunanan.
  • SHA Ting, HOU Hongmin, MENG Xiangna, BAI Suhua, ZHOU Aiqin, SHA Guangli, DAI Hongyi, ZHU Jun
    Abstract (575) PDF (185) RichHTML
    To obtain the transcription factor related to stress conditions in apple rootstock,an apple SBP gene with the full-length cDNA was cloned in Qingzhen 1(apomictic crabapple Pingyitiancha( Malus hupehensis Rehd.)× columnar apple strain CO(Malus × domestica Borkh.) and M26 via homology-based cloning method.The gene cloned was named as MdSBP20 .Bioinformatics analysis to the cDNA showed that the full-length cDNA was 1 362 bp,it's open reading frame possessed 1 362 bp,and encoded 454 amino acids,which had obviously SBP -domain and two zinc finger structures(Zn-1,Zn-2) and the bothway nuclear location signal(NLS).Phylogenetic analysis suggested that MdSBP20 gene had the closer relationship with Pyrus bretschneideri (XM_009339726.1)and Malus domestica (XM_008376435.1).Real-time PCR analysis showed that MdSBP20 gene played a role in response to low temperature,drought,and salt tolerance.It was inferred that QZ1 might has higher resistance than M26 no matter in stress of low temperature,drought,and salt.Based on the results in this experiment, MdSBP20 gene had the significantly effects in apple rootstock response to abiotic stress.
  • BAI Mu-dan, WANG Cai-hong, TIAN Yi-ke, CHEN Bao-yin, LIU Yun-long
    Abstract (528) PDF (309) RichHTML
    Baidu(1)
    GA 2-oxidase(GA2ox)is a critical enzyme in the pathway of gibberellins biosynthesis.In this research,GA2ox gene was isolated from Fuji stem apical tissue by homologous cloning technology.The cDNA sequence of GA2ox was 1 656 bp in length with 3 exons and 2 introns.Its open reading frame was 1 014 bp which encoding a protein of 337 amino acids.Molecular weight and isoelectric point of the protein was 37.679 8 kDa and 6.41,respectively.Conserved domains showed that the enzyme belonged to the class 2-oxoglutarate-dependent dioxygenases.Amino acids homology analysis indicated that the sequence had 51%-97% similarity with those of other reported plants.Cluster analysis showed that GA2ox from pear was clustered together with GA2ox from apple firstly,and followed by that from black cottonwood.
  • DENG Xiao-yun, DAI Hong-yi, LIANG Mei-xia
    Abstract (525) PDF (320) RichHTML
    Ent-kaurene synthase(KS) is a critical enzyme in the pathway ofgibberellins biosynthesis. In this research,ent-kaurene synthasegene in columnar apple,designated as MdKS,was isolated from apple(Malus domes-tica Borkh)stem apical tissue by homologous cloning technology. The full-length cDNA consisted of 2 214 nucleo-tides encoding a putative protein of 737 amino acids. MdKS contained a core functional domain DDXXD of plant class terpene synthase. Amino acids cluster analysis showed that KS from apple was highly homologous with PpKS firstly,had 98% similarity,and followed by that from Castanea sativa,had 73% similarity. The Real-time quantita-tive PCR analysis showed that MdKSgene were always expressed in columnar and standard apple trees during thegrowing season. In the earlygrowing season,the MdKS of standard apples were expressed at higher level than that of columnar apples,but on early June,it was opposite.
  • SUN Ye-hong, ZHANG Yuan, LI Zhong-yong, SHAO Jian-zhu, XU Ji-zhong
    Abstract (522) PDF (325) RichHTML
    Baidu(1)
    The study was conducted to screen molecular markers of salt-tolerance gene in apple rootstock, which providing a theoretical basis for molecular assistant selection breeding in plants salt-tolerance.F1 of Malus micromalus ×S19 were used to screen markers linked to salt-tolerance gene by BSA method and SRAP technology.Four pairs of primers (Me1Em2, Me1Em8, Me6Em12 and Me6Em14) were screened from 128 ones, which expressed polymorphism in parents and DNA pools and totally produced 4 polymorphic fragments.The four pairs of primers were tested by 144 F1 hybrid seedings, and the coincidence rate between hydroponic screening and the SRAP analysis were between 81.94% and 92.36%.The length of the 4 polymorphic fragments (Ⅰ, Ⅱ, Ⅲ and Ⅳ)was between 139 bp and 233 bp by cloning and sequencing.Sequence alignment revealed that sequenceⅠhad relatively highly identity with ATP synthase beta subunit gene(ATP-β) from Photinia fraseri, and there was an identity of 98% for nucleotide sequence.Additionally, other sequences showed partial identity with probable receptor-like protein kinase from Pyrus × Bretschneideri, myosin from Malus domestica, and UDP-glycosyltransferase from Malus domestica, respectively.The 4 markers selected not only could be used in molecular identification of salt tolerance, but also provide a foundation to clone salt-tolerance gene for apple rootstock.
  • HAO Jie, WEI Liang, WANG Xian-ge, LI Xue-ying, SUO Xiang-min, YAN Xin-min, FENG Jian-zhong
    Abstract (513) PDF (236) RichHTML
    The objective of this study is to determine the dynamic changes of the major elements in soil between young Guohong apple trees and adult ones.The soil of young and adult Guohong apple trees had been collected in Shijiazhuang Pomology Institute,Hebei Academy of Agriculture and Forestry Sciences,and the content of the five kinds of major elements had been tested by VISTA-MPX plasma spectrometer,and multivariate statistical analysis and correlation analysis had been done by SPSS software.The result showed that during the whole growth period the content of Boron waved between the young trees and adult ones,while the content of Iron,Zinc had no changes significantly.Typical correlation analysis showed that the content of Manganese were significantly positive correlation between elements in 0-20 cm soil layer,Zinc too.while the content of Zinc were significantly positive correlation between elements in 20-40 cm soil layer,Boron too.The five microelements had no correlation in 40-60 cm soil layer.The results provided scientific theoretical basis for guiding the orchard how to cultivate for higher qualities,and for studying how to enhance the content of the microelement by different cultivation measures.
  • GUO Jin-li, ZHANG Xiang-wen, ZHANG Shu-yuan, NA Guang-yu
    Abstract (510) PDF (360) RichHTML
    The nutrition of leaves and soils with different fertilizer norm and different tree vigour in full fruit period of Jinhong apple(GM256intermediate stock)were studied in order to realize nutrition condition and fertilizing.Results showed:the nutrition of leaves with different fert ilizer norm and different tree vigour were both N content moderate,P and K content insufficient,N,P,K content nutritional disorder;Ca,Mg,Fe,Zn,Cu,B content moderate or enough,Mo content insufficient.The results suggested that the fertilizer ratio of N,P,K content was 2 1.5 1.5-2.
  • MA Hui-li, LÜ De-guo
    Abstract (497) PDF (172) RichHTML
    Baidu(4)
    The photosynthetic characters of Hanfu apple leaves under different light conditions were studied by analyzing the gas exchange and chlorophyll fluorescence parameters.The result showed that the net photosynthetic rate(Pn),stomatal conductance(Gs),intercellular corbon dioxide concentration(Ci),maximal photochemical efficiency(Fv/Fm) and photosynthetic performance index(PI) all decreased gradually in dought condition,and reached the lowest in extreme drought,but recovered slowly after rehydration.At the end of the treatment,Pn of leaves under the full light and shading conditions was respectively 41.4% and 38.1% lower than that before the treatment.Along with the drought stress and drought relief,the density of SPⅡ reaction per excited cross section(RC/CSo),the energy absorbed per unit area(ABS/CSo) and the heat dissipation of energy(DIo/CSo) increased gradually,and started to decline after they reached the highest.The differences of leaf ABS/CSo and DIo/CSo among different lighting conditions reached a significant level after 7-days of drought stress,which was probably related to the quality of leaves.
  • ZHAO Deying, YUAN Jicun, XU Kai, CHENG Cungang, YAN Shuai
    Abstract (493) PDF (531) RichHTML
    In this study,we aimed to identify the differences of tree morphology,accumulation and distribution characteristics of mineral nutrient in root system of Gala apple young tree with different dwarfing interstocks.The results were expected to reveal the relations between the tree dwarfing ability and accumulation,distribution of mineral nutrient in root system.Gala apple saplings (in pots) grafted onto dwarfing interstocks (GM256,Liaozhen No.2,SH1,SH6,SH38,and SH40) with uniform growth vigour were used as the experimental material.After spring shoot growth stopped,plant height and cross-sectional area were measured.The root morphology indexes were analyzed by WINRhizo analysis software.For the measurement of mineral nutrient contents,healthy plants at the same growth stage were removed from the pots,and were dissected and separated into different diameter root system.The contents and accumulations of mineral nutrient were determined.The results showed that plant height and cross-sectional area of Gala apple trees grafted onto dwarfing interstocks were obviously lower than that of the control.The degree of dwarfing of the interstocks followed the order of SH38 > SH1 > SH6 > GM256 > SH40 > Liaozhen No.2.Differences in mineral nutrient contents in different diameter root system of Gala apple young tree among different dwarfing interstocks were obviously different.The mineral nutrient contents in<0.5 mm diameter root system were highest,and the mineral nutrient contents decreased with the increase of root system diameter.The contents of K and Mg of Gala apple root system for SH38 were highest.Root system for SH1 interstocks had the highest Cu,Fe and Zn contents.The accumulations of P,Ca,Fe in all parts of GM256 interstocks root system and that of K,Mg and Zn in>3 mm diameter root system were higher than control and other treatments.The accumulations of K,Mg and Zn in<3 mm diameter root system for Liaozhen No.2 were highest.The mineral nutrient accumulations of SH38,SH1 and SH6 with weak growth vigour were lower than that of Liaozhen No.2,GM256 and CK with strong growth vigour.The optimal interstocks for Gala apple with better dwarfing effect were SH38,SH1 and SH6.In practical application,site condition,soil supplying nutrient capability and nutrient requirement characteristics of different stock-scion combinations should be fully considered,which for realizing the high quality and high efficiency production of apple.
  • LiuGuisen, ZhangLibin
    Abstract (475) PDF (245) RichHTML
    The change of catalase activity of leaves in various years and the change of the enzyme activity in the growing period for varieties of apple were studied. The results showed that there were significant differences both in the varieties and among years. The catalase activity was the highest in Starking Doyle, Grimes and Golden. At the first growing peak of shoots and fruits, the activity was the highest. Along with the decrease of the growing speed of shoots and fruits and the increase of leaf growing,the activity showed a dropping tendency, but the change of its activity related unsignificantly to the environment conditions (temperature and humidity).The change of the activity in the growing periods of these varieties was very identical. There was a significant negative correlation between catalase activity and the percentage of setting fruit before physiological fruit drop (r = - 0.8024). It was considered that the persentage of setting fruit in varieties or trees was related to the catalase activity.
  • ZHANG Xue-mei, LI Bao-guo, QIN Li-zhe, QI Guo-hui, GUO Su-ping
    Abstract (468) PDF (184) RichHTML
    Baidu(5)
    In order to discuss the mechanism of apple self-compatibility,the primer P1:5-'TTTACGCAGC AATATCAG-3'and P2:5-'ACGTTCGGCCAAATA/CATT-3'of apple style S gene were designed according to the conservative amino acid sequence,the primer P SLF1(upriver 5-'3':CTGGTGGTGTTCTTTCCTGTGTAT;backward position 5-'3':ACTTAACTCTTCCCTCAACTCA) and P SLF9 (upriver 5-'3 'CAGGTGCGTGAAAGTGAAA;backward position 5-'3 ':TGAGCCAAGCATAAGAACCT) of apple pollen S gene were designed according to the SLF1 (DQ422810) and SLF9 (AB270792) in GeneBank,the molecular character of self-compatible apple Zaohongxiang was studied in the method of PCR-RFLP,clone and sequence.The result showed that:tow style S gene of self-compatible apple Zaohongxiang did not variation.DNA sequence of pollen S gene which was amplified through pollen S gene primer P SLF1 and P SLF9 compared with the sequence of MdSLF2 and MdSLF9 had a high similarity,which arrived at 94% and 96%,amino acid similarity was 94% and 97%.The similarity of Pollen S gene SLF1? which was amplified through P SLF1 and DNA sequence of MdSLF1 was 83%,and the differ bases were distributed in the whole DNA sequence,so that pollen S gene SLF? could changed into MdSLF2.
  • Jin Tongming, Cui Hongchang
    Abstract (467) PDF (1200) RichHTML
    The feasibility of non destructive quantitative determination of sugar and acid in intact apple by near infrared spectrometer(NIRS)was investigated.Through examination of the second derivatives of the spectra,we found that 914nm,950nm,897nm,and 912nm are the first characteristic wavelengths of sucrose,glucose,fructose and malic acid,respectively.Compared with the calibration data by high performance liquid chromatography,the results obtained at these wavelengths bear the multi correlative coefficients of 0.997,0.992,0.992,0.996 correspondingly,and the standard errors for the test samples are 0.085,0.057,0178,and 0.021,respectively.This indicates that NIRS is sufficiently precise and reliable for practical use in the quantitation of sugars and acids in intact apples.
  • TIAN Yi-ke, BAI Mu-dan, WANG Cai-hong, LIU Yun-long, CHEN Bao-yin
    Abstract (464) PDF (152) RichHTML
    Gibberellines are the most important phtyohormones influencing the plant height of fruit trees.Researches of the genes encoding the critical enzymes in gibberellin biosynthesis are significant to understanding the mechanism of dwarf tree architectures.This study reported the isolation of the MdCPS (GenBank accession number:KC433942.1),encoding CPS in apple, from primary apical shoots of the variety Fuji based on the apple genome database.The gDNA sequence of MdCPS contained 15 exons and 14 introns,and the coding sequence(CDS)of it was 2 400 bp,which encoded a polypeptide of 799 amino acids.The transcript MDP0000147908 that spanned chromosome 11 from location 32433834 to 32439214 in the published Golden delicious apple genome corresponds to this gene.Homology analysis indicated that the deduced MdCPS shared a higher level of similarity(49% -67%)with CPS protein from other plant species.Using the primary apical shoots of the parents and F1 progenies of Fuji(standard)×Telamon(columnar)as plant materials,quantitative real-time PCR(qRT-PCR)analyses showed that even though the transcription level of this gene in the columnar parent was lower than that in the standard parent,there was no significant difference was observed between the two populations of columnar and standard progenies.At the same time,qRT-PCR analysis in the columnar hybrids and their correspondent standard mutants indicated that the expression level of MdCPS was not relevant to the columnar growth habit.These results suggested that the lower content of active gibberellins in columnar apple apical shoots was not distinctively influenced by MdCPS in the early stage of gibberellins synthesis.
  • WANG Cui-cui, JIN Jing, LI Bao-hua, WANG Cai-xia, DONG Xiang-li, ZHANG Zhen-fang
    Abstract (459) PDF (177) RichHTML
    Baidu(4)
    Four types lesions of black tissues type,brown type,black spot type and hardening type were divided in order to determine reasons and infection conditions of black spot disease.The isolation percentage of Alternaria spp.was 89% from black tissues type.The isolation percentage of Trichothecium and Alternaria were 75%,and isolation percentage of A.tenuissima, A.sclerotigenum and T.roseum were the highest.Among them, T.roseum was the most pathogenic pathogen which led to large brown lesion on ripe fruit when infected from wounds.The optimum temperatures for infection by conidia of T.roseum and lesion expansion were 26.8,22.5℃ respectively. A.tenuissima caused large dark or brown lesions on ripe apple fruit when infected from wounds.The optimum temperatures for infection by conidia of A.tenuissima and lesion expansion were 29.4,28.5℃ respectively. A.sclerotigenum owned the highest infection ratio from wounds of mature apple fruit and let to small red-brown lesions on the fruit.The pathogen can fit a wide range of temperature when infection from wounded apple fruit.Conidia of three pathogens could not infected healthy apple.The inoculation with conidia of T.roseum caused significant more lesions on the bagged fruits than the other two pathogens,then the A.tenuissima,and A.sclerotigenum almost did not cause diseased lesions.Pathogens of black spot disease were chance pathogens,and caused disease when met suitable conditions.
  • TIAN Lili, NIU Liang
    Abstract (455) PDF (299) RichHTML
    In order to develop novel disease-resistant transgenic plant materials against ASPV,a virus resistant RNAi plant expression vector was constructed by the method of homologous recombination.With the Malus rootstock of M26,genetic transformation was conducted and positive transgenic plantlets were obtained successfully.Firstly,a conserved segment of coat protein gene of ASPV (489 bp) was cloned by PCR from cDNA of the virus-infective leaves of Royal gala.Then the fragment was inserted into the vector pENTR/SD/D by TOPO cloning technology to form the intermediate vector of pEN-ASPV.After this fragment was replaced and connected into the destination vector pHellsgate12 by LR reaction,the RNAi plant expression vector Phe-ASPV was obtained.And the engineering bacteria EH-ASPV for plant transformation was obtained after the constructed RNAi vector was transformed into Agrobacterium strain EHA105 by alternate freezing and thawing method.By the Agrobaterium mediated method,transformation was conducted with the leaf discs of the Malus rootstock of M26.After culture and subculture for antibiotics screening,bacteria elimination and rooting,compact kanamycin resistant plantlets formed from buds were obtained.After total RNA extracted from the well rooted plantlets,RT-PCR test was conducted and the result showed that the gene fragment of 489 bp carried on the RNAi structure had been transformed into the material of M26,which was expressed in plants on the level of RNA.Through this study,novel transgenic materials were obtained successfully,which laid foundation for disease-resistance evaluation by pathogen inoculation and virus-resistant molecular breeding in the near future.
  • FU You, DONG Wen-cheng, ZHAO Yong-bo
    Abstract (454) PDF (263) RichHTML
    Chang hong is a new apple variety selected f rom Fuji by Changli Insti tute of Pomology,Hebei Academyof Agriculture and Forest ry Sciences.The main characteristics are early ripening,long picking date,g ood coloring,high quility,long sto rage period,wide adaptation.
  • ZHENG Lingjie, MA Hong, ZHANG Yuan, ZHANG Xueying, LI Zhongyong, XU Jizhong
    Abstract (441) PDF (149) RichHTML
    In order to study the molecular characterization and expression patterns of GA20 oxidase gene in apple dwarfing rootstocks,RT-PCR method was used to clone GA20 oxidase gene (GA20ox1) from cDNA of the apple dwarfing rootstocks No.2 and No.36, and the genes and the amino acid sequences, as well as gene expression on rootstocks and the grafted varieties at various times, was analysed, respectively. Results showed that cDNA of GA20ox1 gene coded a 1 179 bp sequence, and derived a protein with 393 amino acids including termination codon, which the predicted protein molecular weight was 44.3 kDa and theoretical isoelectric point was 5.89.The protein contained conserved domain characteristics of GA20ox1 gene family,and phylogenetic analysis showed that the protein sequence homology with SH40 was at 96.9%. Real-time fluorescent quantitative PCR analysis revealed that the GA20ox1 expression of No.36 rootstock was significantly lower than the control (Malus robusta Rehd.) in June and higher than that in July to August, the expression of the varieties grafted on it was significantly lower than control in July. From July to August, GA20ox1 gene expression levels of No.2 rootstock and the grafted varieties were significantly lower than control.
  • CUI Mei xiang, XUE Jin jun, ZHANG Zhi ping, TAI She zhen, ZHAO Zhi jun, ZHANG Fu suo, LI Shao hua
    Abstract (440) PDF (399) RichHTML
    The iron fertilizer by high-pressure trunk-injection indicates: Fe2+ was transported along the central xylem , most of Fe2+ was transported and stored in roots. It was a little difficult for Fe2+ to be transported upto leaves. The speed of transportation reached several hundred centimetres per hour when trunks were injected with iron fertilizer with high-pressure. Regreening of iron deficiency chlorosis trees was slower but the effect of correcting iron deficiency chlorosis lasted longer when trunks were injected with iron fertilizer than iron fertilizer was root-injected.
  • Jin Tongming, Cui Hongchang, Sumio Kawano
    Abstract (438) PDF (338) RichHTML
    In this paper a fast nondestructive analytical mathod to measure sugar content in intact apples-near infrared spectroscopy (NIRS) was introduced. There were clear differences among the NIR second derivative spectra of samples with high, medium, and low Brix values in the 910um wavelength region. This wavelength was characteristic of sucrose and therefore selected as the first calibration wavelength. The highest multiple correlation coefficient of 0.984um was obtained in the linear regression equation that included four optical terms of d2 log (1/R) at 910um, 884um, 843um and 991um and the standard error of calibration (SEC)was 0.36 Brix. A bias-corrected standard error of prediction (SEP) was 0.45 Brix with a bias of 0.11 Brix, suggesting that the NIR method to be practical in determining sugar content in intact apples with sufficient accuracy.
  • LI Ting, LIAN Sen, LI Baohua, LIANG Wenxing, WANG Caixia
    Abstract (424) PDF (127) RichHTML
    To explore the sequence characteristics of β-glucosidase gene VmGluI from Valsa mali var. mali (Vmm)and analyze its expression pattern in the process of pathogen infection,the cDNA sequence of VmGluI was amplified from the strong pathogenic strain LXS080601 by using RT-PCR technology.The phylogenetic relationship,physicochemical properties and secondary structure of the protein coded by VmGluI were analyzed by bioinformatics software.The expression levels of VmGluI in apple tiwgs(Malus domestica Borkh.Fuji) inoculated by Vmm were analyzed by Real-time quantitative PCR.The results showed that the cDNA sequence of VmGluI from Vmm was obtained and its GenBank accession number was KY646110.The open reading frame of 1 689 bp encoded 562 amino acid residues with a predicted molecular weight of 62.7 kDa.VmGluI shared characteristic conserved domains of glycosyl hydrolase family 1. α -helices and random coils were its main elements of secondary structure of VmGluI,and β-turns were less.Multiple sequence alignment and phylogenetic tree analysis showed that the encoded protein had the closest genetic relationship with β-glucosidase genes from Vmm (KUI68239.1) and V.mali var. pyri (KUI56905.1),and the similarities of amino acid sequences were 98.7% and 87.8%,respectively.However,the relationship between VmGluI and other β-glucosidase genes from non-pathogenic fungi was far away.The Real-time quantitative PCR results showed that VmGluI was significantly up-regulated in Fuji tiwgs after inoculation by Vmm.Thus,the authors speculated that VmGluI could paly an important role in the pathogenic process of Vmm.The expression level of VmGluI began to increase significantly in detached twigs at 48 h and the highest expression level was 6.3 times higher than that in the control at 72 h.However,the gene expression level increased significantly at 12 h in living twigs,which was 11.2 times higher than that in the control at 96 h.Although there was a low level of gene expression at 48 h,the amount of gene expression was 16.8 times higher than that in the control at 96 h.The results indicated that expression levels and the time course changes of VmGluI were obvious difference in detached and living twigs inoculated with Vmm.
  • ZHAO Ling-ling, JIANG Zhong-wu, SONG Lai-qing, LIU Mei-ying, TANG Yan, SUN Yan-xia, LI Yuan-jun
    Abstract (419) PDF (299) RichHTML
    Baidu(8)
    To determine the effect of different rootstocks on fruit qualing of variety.The effects of rootstocks on fruit quality and aroma compound of Red General Fuji fruit on 4 different apple rootstocks were investigated consecutively from 2010 to 2012.The result showed that different rootstocks had different effects on the fruit quality and aroma components.Fruits on grafted on Malusp prunifolia (Willd.) Borkh possessed the largest fruit weight,whereas the fruit from the trees on MM106 had the smallest fruit weight.Trees on M26 interstock produced fruits with the biggest firmness,highest Vitamin C content and titratable acid.Fruits on Malusp prunifolia (Willd.) Borkh had the smallest firmness,lowest soluble solid,vitamin C,titratable acid and soluble sugar content.Fruits from the trees on M26 rootstock had highest soluble solid and soluble sugar content.The rootstocks had affected the kinds and the content of aroma compounds of Red General significantly.Fruits with the most kinds of aroma were from the trees on M26 interstock,whereas fruits from the trees on M9 rootstock had the least kinds of aroma.Fruits on Malusp prunifolia (Willd.) Borkh had the highest alcohols and esters content,however the fruits with lowest esters content were from the trees on M9 rootstocks and the fruits with the lowest alcohols were from M26 rootstocks respectively.
  • YIN Ke-suo, ZHANG Xue-yan, DAI Xue-fang, MAO Jia, PU En-tang
    Abstract (418) PDF (386) RichHTML
    Baidu(1)
    In order to assess degradation trends of lambda-cyhalothrin in different kinds of eco-environment planted apple.The field trail were conducted in suburbs of Taiyuan,Kunming and Beijing city,the apples and soils were analyzed by gas chromatography with ECD detector.The result showed that the degradation behaviors of lambda-cyhalothrin accorded with first order kinetics,the half life were from 17.8 to 24.0 days in apple,12.1 to 15.8 days in soil respectively.The last application was done 21 days before harvesting,the residues in apple and soil were not more than 0.2 mg/kg that was the maximum residues limits.The rate of degradation in three sites related to the air temperature and soils characteristic of physics and chemistry,but the difference was not significant.so it is safe to apply lambda-cyhalothrin.
  • LI Rong-fu, LIANG Yan-rong, JIANG Qin-xian, HU Xiao-hong, WANG Shu-li, LIANG Li, QIN Hai-feng
    Abstract (414) PDF (424) RichHTML
    The investigation on the influence of apple hardy dwarfing rootstocks on growth and fruiting habit of the scion cultivars was conducted for five years. The results showed that the compatibility of the scion culti-vars (Jinhong and Hanfu) grafted on various rootstocks(M.Robusta,M Micro}nalus baccata Borkh,inter-stocks,M Toringozdse var Xiaojinensis)was different,hardy dwarfing interstocks 77-34, GMZS6 and M Torzngoidse var Xiaojinenszs show the best compatibility. They were dwarfed, early fast-growing, exhibiting lower tree/crown width ratio, early blossoming, and early bearing in the young apple trees.Compared to ar-borous rootstocks(M. Robusta,M Micromalus baccata Borkh),the early output was obviously increased, and the fruit quality was remarkably improved. Using 77一34 and GMZS6 as inter rootstocks and M Toringoidse var. Xiaojinenszs as hardy dwarfing rootstocks on apple were the best in cold regions.
  • XU Guo-liang, JIN Ai-rong, DU Ji-zhuang, NI Qun-zhou, QIN Li-zhe
    Abstract (410) PDF (292) RichHTML
    Baidu(15)
    Studied the composition of insect communities in apple orchard,and its development grows,communities space and time patterns in central and southern Taihang mountain.Reveals the change of insect communities in growing season,and identifies the advantage pests in different periods and different parts;Larger changes exist in insects diversity,evenness and dominance,in apple orchard ecosystems of Taihang mountain,the role of natural enemies alone can not serve the purpose of controlling pests,prevention and control measures is necessary.
  • HAO Jie, WANG Xian-ge, LI Xue-ying, YAN Xin-min, FENG Jian-zhong
    Abstract (408) PDF (300) RichHTML
    The objective of this study is to determine the effects on the changes of endogenous hormones in apple seedlings by direct planting,top grafting,and grafting on dwarfing intermediate stock respectively. During May to September the apple seedlings of Guohong Changfu 6 by three different grafting methods were selected once per month as the test materials,which included direct planting , top grafting , and grafting on dwarfing intermediate stock. The changes of endogenous hormones' content and their ratios in these apple seedlings leaves were studied on this paper and the results were detected by HPLC in Shijiazhuang Pomology Institute,Hebei Academy of Agriculture and Forestry Sciences. The results showed that by uses of top grafting and grafting on dwarfing intermediate stock,the content of GA3,IAA , CTK in those leaves are lower than that in the leaves by the direct planting trees , but the content of ABA is higher than that in the direct planting trees. The results indicated some plus or minus relevance by the three different grafting methods,and it also provided theoretical evidence for the influence on the different grafting methods shortening the juvenility of apple seedlings.
  • YU Weiwei, CAO Bo, LONG Hong, LI Hui, LI Ai, YAN Guorong
    Abstract (395) PDF (299) RichHTML
    To explore the physiological response of Malus sieversii to salinity stress, Malus sieversii seedlings were cheared with six salinity levels (0,0.2%,0.4%,0.6%,0.8% and 1.0% NaCl) for 4 hours and seven time levels (0,4,8,12,16,20 and 24 hours) in 0.4% NaCl.Contents of proline,MDA,chlorophyll,and soluble sugar in leaves and activity of SOD and POD were mensurated.The results showed that proline content got the peak when NaCl concentration was 0.6% or 12 h in 0.4% NaCl,increasing 63.1% and 27.0% compared to control respectively.Increasing salt concentration and time resulted in higher levels for malondialdehyde content.Chlorophyll content was decreased first,subseguently increased and decreased once more.Among all treatment they were lower than control.Soluble sugar content and the activity of SOD and POD were increased first,then decreased.The results indicated that Malus sieversii could reduce the damage to the plant by accumulating more proline and soluble sugar and increasing the activity of SOD and POD.It was adapted to salinity stress to some extent.
  • ZHANG Shu-ying, QU Tian-li, SUN Yang, DONG Xiang-li, WANG Cai-xia, LI Bao-hua, XIAO Chun
    Abstract (394) PDF (479) RichHTML
    Baidu(6)
    Six isolates of endophytic bacterial strains were isolated from healthy leaves of Agavesisalana Per- rine,in which the strain JM- 3 inhibited canker lesion expansion of Valsa ceratosperma on excised twigs significantly. The cell- free fermentation liquid of JM- 3 inhibited mycelium growth and conidial germination of Valsa ceratosperma. The isolates produced anti- fungi substances,which caused malformation of mycelia and germtubes.The malformed mycelium burst and protoplasm flow- out finally.JM- 3 also showed clear inhibiting effect against mycelial growth of pathogen from several fruit trees and crop.JM- 3 was identified as Bacillus subtilis based on 16S rDNA sequencing and RiboPrinter results.
  • ZHANG Haiyue, XIAO Yuxiong, TIAN Yike, WANG Caihong, YANG Shaolan, LI Yu, LI Yuqi
    Abstract (393) PDF (115) RichHTML
    As the basic component of plant microtubules,tubulins are of great significance to the formation of cytoskeleton. To investigate the effect of one member of the β-tubulin gene family with the transcript number of MDP0000749824.1 on the stem growth,the coding sequence of this gene was cloned from the apple young shoot tips of standard apple variety Yanfu 3 and the columnar variety Telemon,respectively. This sequence was 1 332 bp in length which encoded a peptide with 443 amino acids. The results of DNAMAN alignment showed that the coding sequence of the gene was identical between Yanfu 3 and Telemon.Using DNA of Yanfu 3 and Telemon as templates,1 661 bp nucleotide sequences was obtained by PCR amplification with promoter specific primers. There were six bases differences between them. Promoter sequence analysis revealed that some hormone responsive elements of gibberellin,abscisic acid,methyl jasmonate and salicylic acid existed in it. Cam35S-MDP0000749824-GFP recombinant vector was constructed. Subcellular localization analysis with tobacco leaves indicated that the protein encoded by MDP0000749824.1 was on the cell membrane and microtubules. qRT-PCR detected that the transcript level of this gene in apical stems of columnar apple Telemon was significantly lower than that of standard apple Yanfu 3. It was speculated that the gene could affect the stem elongation be cause its expression level was regulated by hormones.
  • SU Liyan, TIAN Aimei, TAO Guirong, LI Meng
    Abstract (392) PDF (114) RichHTML
    In order to identify the function of MdCaM gene in apple under different abiotic stresses. MdCaM gene was cloned by RT-PCR from apple, and phylogenetic tree was clustered based on amino acid of it. Also, the relative expression levels of MdCaM gene was analyzed by Real-time quantitative PCR (qPCR) method under wound, low-oxygen, high-temperature stress during apple fruit storage. The results showed that Calmodulin gene had high homology in different species, and MdCaM gene had a closer relationship with Arabidopsis thaliana CaM1. qPCR analysis showed that the transcription level of MdCaM was up-regulated in the early stage, then returned to the normal level after wound and low-oxygen (0 O2 and 3%O2) stress, the difference was wound stress peak at 6 h, while low-oxygen (0 O2) stress peak at 1 h. Also, MdCaM was up-regulated under high-temperature (20℃ and 40℃) stress compared to control,and the expression level was the highest at 12 h under stress,which indicated that MdCaM gene might be involved in the whole process of high-temperature stress-responsive. These results suggested that MdCaM might function as an stress-responsive gene under wound,high-temperature,low-oxygen stresses during apple storage. This research provided a theoretical basis for further study of the function and molecular regulation mechanism of MdCaM.
  • LIHui-feng, LUDe-guo, LILin-guang
    Abstract (389) PDF (514) RichHTML
    Evolvement process of root system architecture in apple was observed to study construction rule of root systemarchitecture in apple by moat method and sector digging method, and the result indicated that root distributing modehas been contructed when the tree was five years old, root density and biomass has achieved greatness, and the architecturewas basically established, root system renewval and the adjust of root type were observed after eight years. There wasobviously layer construction for root system in soil, 10- 15 cm under the earth??s surface was great unsteady, 15- 40 cmwas denseness layer of root system, and there were a few roots in the layer of 40 cm under the earth??s surface or deeper.Change of canopy structure could response the condition of root system configuration, root shape of apple was complex onewhich was composed of horizontal roots and sidelong roots.
  • SU Jia-ming, DUAN Xiao-na, YU Qiang, XU Wei-hua, JIANG Zhong-wu, DONG Ya-feng, CHEN Xue-sen
    Abstract (388) PDF (396) RichHTML
    In vitro seedlings subeultured 4 -5 generation of midseason Fuji apple variety Red General were eliminated viruses, and then were detected by ELISA and RT-PCR. Results showed that keeping constant heat treatment conditions at 38℃ for 20 days, the virus elimination rate of Red General apple reached 86.4% -100%, and major apple viruses such as ASSVd, ASGV, ASPV, ApMV and ACLSV were eluted well.
  • Shao Kaiji, Li Dengke, Zhang Zhongten
    Abstract (385) PDF (563) RichHTML
    Dwariin}g stocks of SH series apples are clorsal scion-rooted apple stocks crossed between Ralls and M.honaneas Controls are M9,M7,MM106 clonal scion-rooted stocks and M.bacara seeding stocks.Craft varieties are Yu Hong(No.3 Starking),Golden Decicious,Fuji,etc.They were ccossad in 1978,and established in the autumn of 1982.After 5 consoecutive years' observation on biologcal traits,phenological phases and horticaitural characters as well as analysix and determination on nutrition,net photosyntheric efficiency,stomatic resistance,transpiration intensity and ABA content,a series of SH apple dwarfing stocks have been selected from 4100 stock hybrid single strains.The present paper reports SH3,SH4,SH6,SH9,SH12,SH14,SH15,SH20,SH21,SH29ten outstanding superior stocks from the SH series,Their common characters are early-flowering and early-fruiting,with dwarfing or semi-dwarfing trunks,stress-resistant(drought-resistant,lodging resistant,bolring-resistant),early stable high-yeilding,brightted frult coloring,high quality and rich flavor,high content of solid matter,had fruits suitable for storage,and easy to propagate.Their comprehensive characters sur-pass those of control,that is,new series apple dearing stock of M9,M7,MM106and M.baccata.
  • Song Jinyao, Meng Qingxiang, Liu Yongjun
    Abstract (384) PDF (852) RichHTML
    The physical and chemical properties of peroxidase(POD)in leaves of apple tree were researched by taking apple strain Qingfu 13 as samples.The results suggested that the POD might be divided into two types:the acidic(optimum pH 6.0)and the basic(optimum pH 9.0)enymes.At optimum pH different buffer systems could affect the POD activity.The enzymes are heat stable,and can keep the activity at 80℃ for 2~3 min and at 55℃ for 72 h.The substrate test results revealed that the POD of apple leaves could impel H2Oto oxidize phenol and amine compounds.
  • QI Xiu-dong, LI Hai-shan, WEI Jian-mei, JIA Yan-ru
    Abstract (381) PDF (544) RichHTML
    Baidu(5)
    Fruit of apple (Malus domestica Borkh.cv.Gala) was used to analyses cell wall metabolism and the?related enzymes gene expression and the regulation by 1-MCP,ethephon and cold storage. The results indicated that?fruit firmness had significantly correlated with cell wall components,which was positive to WSP and negative to CSP?and hemi-cellulose,but little relationship with ISP during fruit softening in Gala apple. Both 1-MCP treatment and?cold storage significantly inhibited the increase in WSP content,prevented CSP and hemi-cellulose from degradation. Among the cell wall enzymes,β-Gal activity was the highest and rapidly increased,and its gene expression also?sharply enhanced during fruit softening. Although the increase rate in α-L-Af was no more than β-Gal,both two enzymes had a similar trend in activity and gene expression and strongly inhibited by 1-MCP treatment and cold storage. However,PG and PME activity and gene expression could not be completely inhibited by 1-MCP treatment and?cold storage though they were showed an increase trend. The cell wall enzyme activity had significant negative correlation with fruit softening in Gala apple,and their correlation was dramatically affected by 1-MCP and low temperature. Otherwise,the promotion by ethephon treatment was no more than the inhibition by 1-MCP treatment and cold?storage in cell wall enzymes activity and gene expression in Gala apple fruit.
  • ZHANG Jun-ke, HONG Xiao-juan, MA Feng-wang
    Abstract (378) PDF (202) RichHTML
    Baidu(1)
    In order to study the gene function of GO,obtain the transgenic plant,a plant expression vector pBinG O was constructed by recombinating the G lylate oxidase gene fragment from cloning vector pBSSP5 and the binary vector pBin117 at the EcoR Ⅰsite.The fragment of G lylate oxidase gene was inserted between of CaMV 35Spromotor and NOS terminator in pBin117.The identification results showed that the plant expression binary vector pBinG O was constructed successfully.Subequentely GO gene was introduced into apple leaves mediated by Agrobacterium tumerfaciens.Two transgenic resistant plants were proved by PCR preliminarily that the GO gene had integrated into Apples genome.
  • CHEN Xiao-lin, NIU Cheng-wang, LI Bao-hua, LI Gui-fang, WANG Cai-xia
    Abstract (377) PDF (666) RichHTML
    Baidu(12)
    Activities of the cell wall-degrading enzymes (CWDEs) produced by V. ceratosperma in vitro and in?vivo were detected. The results showed that V. ceratosperma could produce a series of CWDEs including polygalacturonase (PG),polymethylgalacturonase (PMG),cellulose (Cx),β-glucosidase and xylanase. The different levels of?enzyme activities were obtained with V. ceratosperma grown on five media differing in carbon sources. These corresponding days when maximum enzyme activity were detected varied also with the type of carbon source used. The?CWDEs produced by V. ceratosperma grown on three different carbon source all could macerate apple callus,however,the CWDEs produed in xylan medium showed the most powerful macerating ability. In addition,time-course experiments showed that the changes of CWDEs activities in detached apple branches inoculated by V. ceratosperma?were different. The activities of PMG and xylanase were first detected at enhanced levels in diseased branches. The?PMG activity reached the peak at 13 days post-inocualtion and then it decreased,while activities of the other four?enzymes increased as the disease development. In all the CWDEs,the maximum activity of Cx was the lowest,and?xylanase maximum activity was the highest which was 1. 74 -7. 44 times of the other four enzymes.
  • GAO Hua, LU Yu-miao, WANG Lei-cun, WAN Yi-zhen, ZHAO Zheng-yang, HU Yan-ni
    Abstract (375) PDF (585) RichHTML
    Baidu(8)
    Studies of respiratory,ethylene production,dehydration and fruit quality of Qinyang apples during the storage at the room temperature and at 0-1℃. The result showed that the respiratory and ethylene production was inhibited significantly at 0-1℃ storage,ethylene peak at the room temperature storage was 1. 72 times than at 0 -1℃. After storage 42 d at 0-1℃,the fruit was flesh,fruit firmness was higher 26. 4%,acids was higher 0. 31% than the room temperature.
  • ZHANG Xin, DU Guo-qiang, SHI Xiao-xin
    Abstract (371) PDF (366) RichHTML
    The CTAB-guanidinium method, modified CTAB method, and RNAplant Kit method were used to extract the total RNA from the plantlets of apple cultured in vitro, in which contain a lot of carbohydrates and phenolic compound. The CTAB-guanidinium method showed the best results in term of the quality and quantity of yielded RNA with the A260/A230 value of more than 2.0, A260/A280 ranged from 1.8 to 2.0, and the total RNA yield of 16.95μg/g. The modified CTAB and RNAplant Kit methods were a bit short in total RNA extraction because of a little DNA contamination. And the RNAplant Kit method showed advantages of fastness and convenience.
  • LI Ming-xiang, BAI Su-hua, ZHANG Yu-gang, ZHU Jun, DAI Hong-yi
    Abstract (371) PDF (627) RichHTML
    Mannose-binding Lectin(MBL),which belongs to B_LECTIN gene families,was isolated fom the young leaf of apple ( Malus domestica) by homologous cloning technology, named as MdMBL.The cDNA was 1 181 bp in length with an 5'non-coding egion of 20 bp,an 3'non-coding egion of 81 bp and an open eading fame ( OF) of 1 080 bp encoding a potein of 359 amino acids, and the estimated molecula weight and isoelectic point (pI)of the putative potein wee 39.76 kDa and 8.72,espectively.The phylogenetic tee of MBL showed that Md-MBL was closest with gapes MBL, followed by glycine max, and the evolutionay elationships of homologous genes in apple MdMBL2 was fathest.Quantitative eal-time PC analysis shows that the gene is tissue-specific and ex-pessed highest in stems, the lowest in flowes;The expession of MdMBL was pomoted inceased with the cold stess and the mechanical damage stess;Exogenous SA could induce up-egulation of MdMBL expession.
  • Yan Yuhua, Duan Jianjun
    Abstract (367) PDF (324) RichHTML
    This experiment was conducted in the Tuanchenguoyuan Apple Orchard near Fragrant Hill Park, Beijing in 1985. The white sweet clover Mclilotus albus was grown as a cover crop between the rows of apple tree. The population dynamics of natural enemies,such as Orius minutus,,Chrysopa sinica,Scolothrips, sex-macnlatus and Amblyseius pseudolongispinosus, and the arthropod pests, such as Tetranychus viennensis, were observed. After the middle of July, the ratio of T.vicnnensis to its natural enemies on the apple trees was much lower in the cover cropping orchard than in the control orchards without the cover crop. On July 12, when the population of T. vienncnsis was most significantly different between the orchards with and without cover crop, there were 2.54 active mite stages per leaf and 8.80 active mite stages per leaf in test and control orchard respectively. During the entire growing season, miticide was applied only once. Obviously.cover cropping in apple orchards should be considered as one of important methods of IPM.
  • MA Qiang, QIAo Guo biao, ZHUANG Xia, ZHANG Xiao wei
    Abstract (365) PDF (506) RichHTML
    Baidu(3)
    In order to reduce the apple trees canker effectively,the research compared the activity of pectolases of pathogens under different concentration penicillin which cultivated between sicken trees and PA. Result showed that the activity of pectolases of pathogens in sicken trees was restrained significantly,whereas the activity of pectolases of pathogens in PA was not effected. The best concentration of penicillin was 1. 2 × 10U/L,and the pectolases of pathogens in sicken trees reduced 82 % under this concentration.
  • Xiang Dianfang, Song Jinyao, Liu Yongjun, Zhang Deming, Chen Shuangying
    Abstract (363) PDF (511) RichHTML
    In six apple strains or stocks, including Orin, Jonagold, Nagafu 2, Akifu 1, M7 and M26, the peroxidase activity in the mature leaves of the virus-free seedlings were obviously decreased, compared with oh (viruliferous ones). The nitrate reductase activity in the mature leaves of virus-free Orin, Jonagold and Nagafu 2 was also remarkably higher than their oh. The contents of protein and amino acid in the mature leaves of the three strains were much lower, but in the browses and the shoot cortex were higher, and nitrite concentration in them was decreased. After virus-free treatment the browning degree of the tissues extraction of the three strains was notably decreased.
  • CHEN Chen, WANG Li-xia, ZHAO Hai-yong, SHAO Lei
    Abstract (361) PDF (664) RichHTML
    A field experiment was conducted to study the effects of controlled release fertilizers blended withcommon fertilizers on yield, quality, and economic benefit of apple in order to provide scientific evidence and technicaladvice for applying controlled release fertilizers on apple. The result showed that the available nutrient in soil of SFtreatment decreased gradually in a growing season. The controlled release fertilizers blended with common fertilizerssolved the problem of nutrient's slow release in a short time after being applied and met with the nutrient requirementof plant in a growing season. The application rate of CRF1 was the same as that of SF, but the yield, quality and economic benefit of CRF1 were better than that of SF. The application rate of CRF2 and CRF3 was lower than that of SF,but the yield, quality and economic benefit of CRF2 and CRF3 weren't lower. Considering prompting the palate offruit, decreasing the application and increasing the economic benefit, the CRF3 was the optimal treatment.
  • TAN Dong-mei, XU Xue-feng, LI Tian-zhong, WANG Yi, HAN Zhen-hai
    Abstract (357) PDF (279) RichHTML
    Seedlings of Malus sieversii treated with polyethylene glycol (PEG6000) were used to study the characteristics of Malus species under drought stress. Programmed cell death occured in sieversii under drought stress, which can be observed through cellular ultrastructure of leaves and roots and had the following features: under drought stress, the changes of organelle morphosis in roots were ealier than those in leaves. In leaves the changes of organelle morphosis in spongy mesophylls were earlier than those in palisade parenchymas. In roots the changes of organelle morphosis in cortical cells were earlier than those in pericycle cells. Results showed that an alternative method to indentify programmed cell death in Malus plants was to observe the cellular ultrastructure.
  • SUN Xiao-qian, DAI Hong-yi, ZHANG Yu-gang
    Abstract (355) PDF (396) RichHTML
    Baidu(4)
    Based on the results of previous study on columnar apple using RNA-seq technology,two full-length?cDNA sequences of homologous gene of MADS-box from columnar apple were cloned by RT-PCR,which named as?MdSOCla and MdSOClb. The MdSOCla contains an 708 bp open reading flame (ORF) corresponding to a deduced?protein of 235 amino acids,while the estimated molecular weight and isoelectric point (pI) of the putative protein?were 26. 95 kDa and 9. 13. The MdSOClb with an open reading flame (ORF) of 717 bp,encoding 238 amino acids?with a predicted molecular mass of 27. 49 kDa and a pI of 9. 61. The identity of nucleotide between MdSOCla and?MdSOClb was 83. 49%,and it was 73. 72% was deduced amino acid sequence. The results indicated that MdSOCla?and MdSOClb had 1 to 75 amino acids highly conserved MADS-box domain,105 to 170 for the K-box domain. The?phylogenetic tree of SOC1 showed that MdSOCla and MdSOClb were closest with apple SOC1,followed by orange?SOC1,and the evolutionary relationships of homologous genes in Arabidopsis SOC1 was farthest. Apple,orange and?sinningia were clustered together,while soybean,cowpea,grape,Arabidopsis thaliana,strawberries and magnolia were?clustered to another group. Predicted protein secondary structure showed that MdSOCla protein had the structure with?8 α-helix,5 β-sheet region,13 β-turn;and MdSOClb protein had 11 α-helix,7 β-sheet region and11 β-turn. Those results speculated that MdSOCla and MdSOClb played a different role in regulation in flower development.
  • Zhao Baige, KongJian, Shen Xiaocheng, Wang Wenxi, Cheng Hongmei, Zhang Guifen
    Abstract (353) PDF (463) RichHTML
    Ring rot of apple fruit is one of the important apple diseases in Henan province. Experiments on the biological control of ring rot of apple fruit were carried out in laboratory and field in Zhengzhou from 1990 to 1992. The results showed that antibiotics 751 and B 903 have bacteriostatic action for Physalospora piricola. The bacteriostatic diameters were 11.77mm - 18.70mm. The rate of rot apple fruits and the number of spot in leaves treated with antibiotic 751 (100 time of ferment solution) and Bordeaux mixture alternately were lower than that treated with chemicals. The treatment of apple fruits with QGF (a compound of antibiotic 751) before storage resulted in controling diseases of the fruits and keeping them fresh more effectively.
  • Xia Guohai, Luo Xinsu
    Abstract (349) PDF (169) RichHTML
    The compositions and the translocation characters of Cassimilates at theshootgrowing stage in potcultured young Liao Fu'apple trees were studied during 1986-1987.The results have shown that the major compositions of assimilates in appleleaves are sugar,sorbitol content is the maximum,sucrose the second,glucose and fructoseonly a little.The amino acids synthesized in leaves are mainly aspartic acid,serine alanineand asparagine.The export rate of sorbitol out of leaves is higher tnan that of sucrose.Sorbitol is dominant in shortdistance transport from the natured leaves up to the developingparts,but sucrose is mainly transported in long distance to other organs.At the shootgrowing stage of young apple trees,carbon assimilates can finish the leafroottop cyclewithin 24 hours.Parts of sugar imported in roots are transformed into organic acids andamino acids,for example asparagine,glutamine and aspartic acid,then translocated back tothe top of tree.The distribution of the substance among the top parts is strictly regulated bymetabolism.