Abstract: In order to discuss the mechanism of apple self-compatibility,the primer P1:5-'TTTACGCAGC AATATCAG-3'and P2:5-'ACGTTCGGCCAAATA/CATT-3'of apple style S gene were designed according to the conservative amino acid sequence,the primer P SLF1(upriver 5-'3':CTGGTGGTGTTCTTTCCTGTGTAT;backward position 5-'3':ACTTAACTCTTCCCTCAACTCA) and P SLF9 (upriver 5-'3 'CAGGTGCGTGAAAGTGAAA;backward position 5-'3 ':TGAGCCAAGCATAAGAACCT) of apple pollen S gene were designed according to the SLF1 (DQ422810) and SLF9 (AB270792) in GeneBank,the molecular character of self-compatible apple Zaohongxiang was studied in the method of PCR-RFLP,clone and sequence.The result showed that:tow style S gene of self-compatible apple Zaohongxiang did not variation.DNA sequence of pollen S gene which was amplified through pollen S gene primer P SLF1 and P SLF9 compared with the sequence of MdSLF2 and MdSLF9 had a high similarity,which arrived at 94% and 96%,amino acid similarity was 94% and 97%.The similarity of Pollen S gene SLF1? which was amplified through P SLF1 and DNA sequence of MdSLF1 was 83%,and the differ bases were distributed in the whole DNA sequence,so that pollen S gene SLF? could changed into MdSLF2.

Key words: Self-compatible, Apple, Style S gene, Pollen S gene

CLC Number: 

• Q78

• S66.1