Cloning and Characterization of Two Aquaporin Genes,AsPIP1;1 and AsTIP2;1,and Their Response to Salt Stress in Garlic

doi:10.7668/hbnxb.20195933

Abstract

Abstract:

Aquaporins(AQPs)are primarily responsible for the transmembrane transport of water molecules and are involved in processes such as plant growth,development, and responses to environmental stress. Garlic is an important vegetable crop widely cultivated worldwide, but there are currently few reports on salt-tolerance genes in garlic.It aimed to clone the genes AsPIP1;1 and AsTIP2;1, encoding plasma membrane intrinsic protein (PIP) and tonoplast intrinsic protein (TIP) respectively, from garlic, analyze their sequence characteristics, investigate their expression patterns under salt stress conditions, and evaluate their potential roles in garlic salt tolerance. We cloned the AsPIP1;1 and AsTIP2;1 genes from garlic using RT-PCR. Bioinformatics methods were employed to analyze the open reading frames, encode amino acid sequences, and conserve domains of the cloned genes. Furthermore, the expression profiles of AsPIP1;1 and AsTIP2;1 in different tissues and under salt stress conditions were detected using Quantitative Real-time PCR. The results showed that the open reading frames of the AsPIP1;1 and AsTIP2;1 genes were 867, 747 bp in length, encoding 288,248 amino acids, respectively, with the conserved NPA motifs. AsPIP1;1 and AsTIP2;1 were highly expressed in garlic leaves and roots, and salt stress strongly induced changes in the transcriptional levels of both genes. Furthermore,AsPIP1;1 and AsTIP2;1 may interact with other AQP proteins, cell wall-associated proteins, and transporter proteins to adapt to the salt stress environment. These results indicate that the AsPIP1;1 and AsTIP2;1 genes may be involved in the garlic plant's response to salt stress.

Key words: Garlic, Salt stress, Aquaporins, Expression analysis, AsPIP1;1, AsTIP2;1

CLC Number:

WU Jiaqi, XU Yujie, CHEN Yangyang, REN Xuqin, ZHOU Jin, XIONG Aisheng, WANG Guanglong. Cloning and Characterization of Two Aquaporin Genes,AsPIP1;1 and AsTIP2;1,and Their Response to Salt Stress in Garlic[J]. Acta Agriculturae Boreali-Sinica, 2026, 41(1): 64-70. doi: 10.7668/hbnxb.20195933.

/ / Recommend / Download Citations

URL: http://www.hbnxb.net/EN/10.7668/hbnxb.20195933

http://www.hbnxb.net/EN/Y2026/V41/I1/64

Figures/Tables 8

Tab.1 Primers used for AsPIP1;1 and AsTIP2;1 gene cloning and Quantitative Real-time PCR

基因名称 Gene name	基因克隆引物(上游/下游) Primers for gene cloning (Forward/Reverse)	荧光定量PCR引物(上游/下游) Primers for Quantitative Real-time PCR (Forward/Reverse)
AsPIP1;1	ATGGAGGGTAAAGAAGAAGATGT/TTAAGATCT GCTTTTGAATGGAA	CGTCGTTAAGTCTCCGTCCAAGT/ACAACATTAGCACCGC CACCTT
AsTIP2;1	ATGGTAAAGCTAGCTTTTGGTAGCA/TTAAGGAT AATCCTCAGCGACAGGT	GGCGACTCTCTCAGCAAAGCAT/ACAGGCAAGCGACGGA GGAT

Fig.1 RT-PCR amplification patterns of AsPIP1;1 and AsTIP2;1 from garlic M.DNA Marker;1.AsPIP1;1;2.AsTIP2;1.

Fig.2 Nucleotide acid and deduced amino acid sequences of AsPIP1;1 and AsTIP2;1 from garlic A.AsPIP1;1;B.AsPIP2;1.The grey shaded areas indicate the conserved motif,Asn-Pro-Ala (NPA),peculiar to MIP superfamily.

Fig.3 Phylogenetic tree of PIPs and TIPs from garlic and Arabidopsis

Fig.4 Conserved motifs of PIP and TIP family proteins in garlic and Arabidopsis

Fig.5 Sequence logos of PIP and TIP domains in garlic and Arabidopsis The overall height of the stack represents the level of sequence conservation;heights of residues within a stack indicate the relative frequency of each residue at that position.

Fig.6 The interaction networks of AsPIP1;1 and AsTIP2;1 in garlic according to the orthologs in Arabidopsis

Fig.7 Expression analysis of AsPIP1;1 and AsTIP2;1 genes in garlic under salinity stress Different lowercase letters in the same tissue indicate significant differences at the 0.05 level.

References 36

[1]	Vaziriyeganeh M, Khan S, Zwiazek J J. Analysis of aquaporins in northern grasses reveal functional importance of Puccinellia nuttalliana PIP2;2 in salt tolerance[J]. Plant,Cell & Environment, 2023, 46(7):2159-2173.doi:10.1111/pce.14589. URL
[2]	Zhu C L, Lin Z M, Yang K B, Lou Y F, Liu Y, Li T K, Li H, Di X L, Wang J F, Sun H Y, Li Y, Li X P, Gao Z M. A bamboo'PeSAPK4-PeMYB99-PeTIP4-3' regulatory model involved in water transport[J]. New Phytologist, 2024, 243(1):195-212.doi:10.1111/nph.19787. URL
[3]	Ding L, Fox A R, Chaumont F. Multifaceted role and regulation of aquaporins for efficient stomatal movements[J]. Plant,Cell & Environment, 2024, 47(9):3330-3343.doi:10.1111/pce.14942. URL
[4]	Ahmed S, Kouser S, Asgher M, Gandhi S G. Plant aquaporins:a frontward to make crop plants drought resistant[J]. Physiologia Plantarum, 2021, 172(2):1089-1105.doi:10.1111/ppl.13416. URL
[5]	Li X T, Guo Y R, Ling Q P, Guo Z J, Lei Y W, Feng X M, Wu J Y, Zhang N N. Advances in the structure,function,and regulatory mechanism of plant plasma membrane intrinsic proteins[J]. Genes, 2025, 16(1):10.doi:10.3390/genes16010010. URL
[6]	Kudoyarova G, Veselov D, Yemelyanov V, Shishova M. The role of aquaporins in plant growth under conditions of oxygen deficiency[J]. International Journal of Molecular Sciences, 2022, 23(17):10159.doi:10.3390/ijms231710159. URL
[7]	Ozu M, Alvear-Arias J J, Fernandez M, Caviglia A, Peña-Pichicoi A, Carrillo C, Carmona E, Otero-Gonzalez A, Garate J A, Amodeo G, Gonzalez C. Aquaporin gating:a new twist to unravel permeation through water channels[J]. International Journal of Molecular Sciences, 2022, 23(20):12317.doi:10.3390/ijms232012317. URL
[8]	Wan Q, Li Y X, Cheng J J, Wang Y, Ge J, Liu T L, Ma L Y, Li Y, Liu J N, Zhou C L, Li H C, Sun X, Chen X L, Li Q X, Yu X Y. Two aquaporins,PIP1;1 and PIP2;1,mediate the uptake of neonicotinoid pesticides in plants[J]. Plant Communications, 2024, 5(5):100830.doi:10.1016/j.xplc.2024.100830. URL
[9]	Yu X S, Wang H R, Lei F F, Li R Q, Yao H P, Shen J B, Ain N U, Cai Y. Structure and functional divergence of PIP peptide family revealed by functional studies on PIP1 and PIP2 in Arabidopsis thaliana[J]. Frontiers in Plant Science, 2023, 14:1208549.doi:10.3389/fpls.2023.1208549. URL
[10]	Bots M, Feron R, Uehlein N, Weterings K, Kaldenhoff R, Mariani T. PIP1 and PIP2 aquaporins are differentially expressed during tobacco anther and stigma development[J]. Journal of Experimental Botany, 2005, 56(409):113-121.doi:10.1093/jxb/eri009. pmid: 15520027
[11]	Fetter K, Van Wilder V, Moshelion M, Chaumont F. Interactions between plasma membrane aquaporins modulate their water channel activity[J]. The Plant Cell, 2004, 16(1):215-228.doi:10.1105/tpc.017194. URL
[12]	Zhang S, Feng M, Chen W, Zhou X F, Lu J Y, Wang Y R, Li Y H, Jiang C Z, Gan S S, Ma N, Gao J P. In rose,transcription factor PTM balances growth and drought survival via PIP2;1 aquaporin[J]. Nature Plants, 2019, 5(3):290-299.doi:10.1038/s41477-019-0376-1.
[13]	Bienert M D, Diehn T A, Richet N, Chaumont F, Bienert G P. Heterotetramerization of plant PIP1 and PIP2 aquaporins is an evolutionary ancient feature to guide PIP1 plasma membrane localization and function[J]. Frontiers in Plant Science, 2018, 9:382.doi:10.3389/fpls.2018.00382. pmid: 29632543
[14]	Liu L H, Ludewig U, Gassert B, Frommer W B, von Wirén N. Urea transport by nitrogen-regulated tonoplast intrinsic proteins in Arabidopsis[J]. Plant Physiology, 2003, 133(3):1220-1228.doi:10.1104/pp.103.027409. URL
[15]	Song L, Nguyen N, Deshmukh R K, Patil G B, Prince S J, Valliyodan B, Mutava R, Pike S M, Gassmann W, Nguyen H T. Soybean TIP gene family analysis and characterization of GmTIP1;5 and GmTIP2;5 water transport activity[J]. Frontiers in Plant Science, 2016, 7:1564.doi:10.3389/fpls.2016.01564. pmid: 27818669
[16]	Footitt S, Clewes R, Feeney M, Finch-Savage W E, Frigerio L. Aquaporins influence seed dormancy and germination in response to stress[J]. Plant,Cell & Environment, 2019, 42(8):2325-2339.doi:10.1111/pce.13561. URL
[17]	Rodrigues M I, Takeda A A S, Bravo J P, Maia I G. The Eucalyptus tonoplast intrinsic protein (TIP)gene subfamily:genomic organization,structural features,and expression profiles[J]. Frontiers in Plant Science, 2016, 7:1810.doi:10.3389/fpls.2016.01810. pmid: 27965702
[18]	Wang Y, Zhang Y Q, An Y C, Wu J Y, He S B, Sun L R, Hao F S. Wheat TaTIP4;1 confers enhanced tolerance to drought,salt and osmotic stress in Arabidopsis and rice[J]. International Journal of Molecular Sciences, 2022, 23(4):2085.doi:10.3390/ijms23042085. URL
[19]	Yi X F, Sun X C, Tian R, Li K X, Ni M, Ying J L, Xu L, Liu L W, Wang Y. Genome-wide characterization of the aquaporin gene family in radish and functional analysis of RsPIP2-6 involved in salt stress[J]. Frontiers in Plant Science, 2022, 13:860742.doi:10.3389/fpls.2022.860742. URL
[20]	Zhang H M, Zhu J H, Gong Z Z, Zhu J K. Abiotic stress responses in plants[J]. Nature Reviews Genetics, 2022, 23(2):104-119.doi:10.1038/s41576-021-00413-0.
[21]	Pandey S P, Chen C, Singh S, Maniar J N, Mishra A, Bakshi S, Mishra V K, Sharma S. Transcriptional response of cultivated peanut (Arachis hypogaea L.) roots to salt stress and the role of DNA methylation[J]. Plant Cell Reports, 2025, 44(6):124.doi:10.1007/s00299-025-03515-9. pmid: 40397176
[22]	Arshad K, Wang Y, Han S Q, Zheng M Y, Xie M Y, Song Y M, Hu L F, Ou R, Gu M Y, Ouyang C, Zhao S C, He J B, Li Y, Fang X D, Gai J Y, Jin S C, Zhang J P. GWAS on HTP-enabled dynamic traits unravels novel genetic architecture of salt tolerance in soybean[J]. The Plant Journal, 2025, 122(4):e70177.doi:10.1111/tpj.70177. URL
[23]	Seo H U, Jang C S. Mutation of a gene with PWWP domain confers salt tolerance in rice[J]. Plant Molecular Biology, 2025, 115(3):63.doi:10.1007/s11103-025-01581-x. pmid: 40327136
[24]	Jain M, Patil N, Mohammed A, Hamzah Z. Valorization of garlic (Allium sativum L.) byproducts:bioactive compounds,biological properties,and applications[J]. Journal of Food Science, 2025, 90(3):e70152.doi:10.1111/1750-3841.70152. URL
[25]	周倩怡, 黄思杰, 田洁. 大蒜2个中性/碱性转化酶基因AsNI的克隆与表达分析[J]. 华北农学报, 2023, 38(4):54-64.doi:10.7668/hbnxb.20193859.
	Zhou Q Y, Huang S J, Tian J. Cloning and expression analysis of two neutral/alkaline invertase gene in garlic[J]. Acta Agriculturae Boreali-Sinica, 2023, 38(4):54-64. doi: 10.7668/hbnxb.20193859
[26]	Wang G L, Ren X Q, Liu J X, Yang F, Wang Y P, Xiong A S. Transcript profiling reveals an important role of cell wall remodeling and hormone signaling under salt stress in garlic[J]. Plant Physiology and Biochemistry, 2019, 135:87-98.doi:10.1016/j.plaphy.2018.11.033. URL
[27]	Gasteiger E. ExPASy:the proteomics server for in-depth protein knowledge and analysis[J]. Nucleic Acids Research, 2003, 31(13):3784-3788.doi:10.1093/nar/gkg563. URL
[28]	Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5:molecular evolutionary genetics analysis using maximum likelihood,evolutionary distance,and maximum parsimony methods[J]. Molecular Biology and Evolution, 2011, 28(10):2731-2739.doi:10.1093/molbev/msr121. URL
[29]	Wang G L, Tian C, Wang Y P, Wan F X, Hu L B, Xiong A S, Tian J. Selection of reliable reference genes for quantitative RT-PCR in garlic under salt stress[J]. PeerJ, 2019, 7:e7319.doi:10.7717/peerj.7319.
[30]	Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2^-ΔΔCtmethod[J]. Methods, 2001, 25(4):402-408.doi:10.1006/meth.2001.1262. pmid: 11846609
[31]	Zhou H P, Shi H F, Yang Y Q, Feng X X, Chen X, Xiao F, Lin H H, Guo Y. Insights into plant salt stress signaling and tolerance[J]. Journal of Genetics and Genomics, 2024, 51(1):16-34.doi:10.1016/j.jgg.2023.08.007. URL
[32]	Wang J J, Yang L L, Chai S S, Ren Y F, Guan M, Ma F W, Liu J Y. An aquaporin gene MdPIP1;2 from Malus domestica confers salt tolerance in transgenic Arabidopsis[J]. Journal of Plant Physiology, 2022, 273:153711.doi:10.1016/j.jplph.2022.153711. URL
[33]	Gambetta G A, Fei J, Rost T L, Knipfer T, Matthews M A, Shackel K A, Walker M A, McElrone A J. Water uptake along the length of grapevine fine roots:developmental anatomy,tissue-specific aquaporin expression,and pathways of water transport[J]. Plant Physiology, 2013, 163(3):1254-1265.doi:10.1104/pp.113.221283. pmid: 24047863
[34]	Guo A H, Hao J F, Su Y, Li B, Zhao N, Zhu M, Huang Y, Tian B M, Shi G Y, Hua J P. Two aquaporin genes,GhPIP2;7 and GhTIP2;1,positively regulate the tolerance of upland cotton to salt and osmotic stresses[J]. Frontiers in Plant Science, 2022, 12:780486.doi:10.3389/fpls.2021.780486. URL
[35]	Martins C P S, Neves D M, Cidade L C, Mendes A F S, Silva D C, Almeida A F, Coelho-Filho M A, Gesteira A S, Soares-Filho W S, Costa M G C. Expression of the Citrus CsTIP2;1 gene improves tobacco plant growth,antioxidant capacity and physiological adaptation under stress conditions[J]. Planta, 2017, 245(5):951-963.doi:10.1007/s00425-017-2653-4. URL
[36]	Rahman A, Kawamura Y, Maeshima M, Rahman A, Uemura M. Plasma membrane aquaporin members PIPs act in concert to regulate cold acclimation and freezing tolerance responses in Arabidopsis thaliana[J]. Plant and Cell Physiology, 2020, 61(4):787-802.doi:10.1093/pcp/pcaa005. pmid: 31999343

Please choose a citation manager

Content to export