Expression and Bioinformatics Analysis of lncRNA TCONS _ 00143126 in Inflammatory Response of Bovine Mammary Epithelial Cells

doi:10.7668/hbnxb.20194818

Abstract

Abstract:

In order to investigate the expression pattern and biological function of lncRNA TCONS_00143126 in E.coli type mastitis of cows in depth.This study used cDNA from bovine mammary epithelial cells as a template,and confirmed the presence of lncRNA TCONS_00143126 using PCR cloning and sequencing techniques.Subcellular localization analysis of lncRNA was performed,and potential target miRNAs and genes were predicted.The potential mechanism of its action in bovine mastitis was explored through KEGG pathway enrichment analysis.In addition,LPS was used to induce bMECs to construct an in vitro model of bovine mastitis,and the expression of lncRNA TCONS_00143126 in LPS-induced bMECs at 6,12 and 24 h was detected by RT-qPCR.The results showed that lncRNA TCONS_00143126 was real,and its expression was significantly up-regulated in LPS-induced bMECs,and it was mainly distributed in the nucleus.The results of target gene prediction and KEGG enrichment analysis showed that lncRNA TCONS_00143126 might regulate inflammatory signaling pathways such as JAK-STAT,mTOR and MAPK by targeting miRNAs(bta-miR-133a,bta-miR-193a-5p and bta-miR-375,etc.)and target genes(IFNE,SLC2A10,MEX3B),and then play a role in the inflammation of bovine mammary epithelial cells.

Key words: Dairy cow, lncRNA TCONS_00143126, Mammary epithelial cell, Inflammation, Bioinformatics analysis

FENG Fen, LI Yanxia, WANG Jinpeng, DONG Yiwen, LUORENG Zhuoma, WANG Xingping. Expression and Bioinformatics Analysis of lncRNA TCONS _ 00143126 in Inflammatory Response of Bovine Mammary Epithelial Cells[J]. Acta Agriculturae Boreali-Sinica, 2025, 40(1): 199-206. doi: 10.7668/hbnxb.20194818.

/ / Recommend / Download Citations

URL: http://www.hbnxb.net/EN/10.7668/hbnxb.20194818

http://www.hbnxb.net/EN/Y2025/V40/I1/199

Figures/Tables 7

Tab.1 Primer information

引物名称 Primer name	引物序列(5'—3') Primer sequence(5'—3')	产物长度/bp Product length	退火温度/℃ Annealing temperature
TCONS_00143126	F:GAGATCAGCCCTGGTTGTTT	919	Touch down PCR(58~50)
	R:TGGGCCTACCCTATGCAAAT
TCONS_00143126	F:GGAGCTATTTCCTCTGATTC	217	60
	R:GTGCTGTTTGTTCTGTCTGA
IL-6	F:CACTCCATTCGCTGTCT	227	60
	R:GTGTCTCCTTGCTGCTT
IL-8	F:ACACATTCCACACCTTTCCAC	149	60
	R:ACCTTCTGCACCCACTTTTC
GAPDH	F:GGCATCGTGGAGGGACTTATG	89	60
	R:CCAGTGAGCTTCCCGTTGAG
RPS18	F:GTGGTGTTGAGGAAAGCAGACA	186	60
	R:TGATCACACGTTCCACCTCATC
U6	F:GCTTCGGCAGCACATATACTAAAAT	79	60
	R:CGCTTCACGAATTTGCGTGTCAT

Fig.1 PCR amplification and sequencing results of lncRNA TCONS-00143126

Fig.2 The mRNA expression patterns of IL-6,IL-8 and lncRNA TCONS_00143126 in LPS-induced bMECs The different lowercase letters represent significant differences(P<0.05).

Tab.2 The prediction results of subcellular localization of lncRNA TCONS _ 00143126 in bMECs

亚细胞定位 Subcellular locations	预测分数 Prediction score
细胞核 Nucleus	0.312 1
细胞质 Cytoplasm	0.276 9
核糖体 Ribosome	0.128 2
细胞溶质 Cytosol	0.121 4
外泌体 Exosome	0.161 4
定位预测 Location prediction	细胞核

Fig.3 Nucleoplasmic localization of lncRNA TCONS_00143126

Fig.4 KEGG functional annotation analysis of lncRNA TCONS_00143126 1.RIG-I-like receptor signaling pathway;2.JAK-STAT signaling pathway;3.Cytokine-cytokine receptor interaction;4.Thyroid cancer;5.Central carbon metabolism in cancer;6.Non-small cell lung cancer;7.Autophagy-animal;8.mTOR signaling pathway;9.Calcium signaling pathway;10. Herpes simplex virus infection.

Fig.5 KEGG annotation of miRNAs target genes absorbed by lncRNA TCONS_00143126 A.bta-miR-133a:1.AMPK signaling pathway,2.Adrenergic signaling in cardiomyocytes,3.Bile secretion,4.Butanoate metabolism,5.Cell adhesion molecules(CAMs),6.Circadian rhythm,7.Dopaminergic synapse,8.GABAergic synapse,9.Inositol phosphate metabolism,10.Insulin secretion,11.Longevity regulating pathway-mammal,12.Neuroactive ligand-receptor interaction,13.Parathyroid hormone synthesis,secretion and action,14.Regulation of actin cytoskeleton,15.Renin secretion,16.Renin-angiotensin system,17.Shigellosis,18.Sphingolipid metabolism,19.Terpenoid backbone biosynthesis,20.beta-Alanine metabolism;B.bta-miR-193a-5p:1.Cell adhesion molecules(CAMs),2.Complement and coagulation cascades,3.Glycosylphosphatidylinositol(GPI)-anchor biosynthe,4.Hematopoietic cell lineage,5.Herpes simplex infection,6.Influenza A,7.Leishmaniasis,8.MAPK signaling pathway,9.MicroRNAs in cancer,10.NOD-like receptor signaling pathway,11.Neomycin,kanamycin and gentamicin biosynthesis,12.Osteoclast differentiation,13.Peroxisome,14.Phenylalanine metabolism,15.Phenylalanine,tyrosine and tryptophan biosynthesis,16.Phosphonate and phosphinate metabolism,17.Prostate cancer,18.Rap1 signaling pathway,19.Toxoplasmosis,20.Ubiquitin mediated proteolysis;C.bta-miR-375:1.Aminoacyl-tRNA biosynthesis,2.Bile secretion,3.Circadian rhythm,4.Dilated cardiomyopathy(DCM),5.Fatty acid elongation,6.Fluid shear stress and atherosclerosis,7.Glucagon signaling pathway,8.Hematopoietic cell lineage,9.Hypertrophic cardiomyopathy(HCM),10.Longevity regulating pathway-multiple species,11.MAPK signaling pathway,12.Phosphatidylinositol signaling system,13.Phospholipase D signaling pathway,14.Progesterone-mediated oocyte maturation,15.Protein processing in endoplasmic reticulum,16.Sulfur relay system,17.Tight junction,18.Toll and Imd signaling pathway,19.Ubiquitin mediated proteolysis,20.cAMP signaling pathway.

References 41

[1]	Schukken Y H, Hertl J, Bar D, Bennett G J, González R N, Rauch B J, Santisteban C, Schulte H F, Tauer L, Welcome F L, Gröhn Y T. Effects of repeated gram-positive and gram-negative clinical mastitis episodes on milk yield loss in Holstein dairy cows[J]. Journal of Dairy Science, 2009, 92(7):3091-3105.doi:10.3168/jds.2008-1557. pmid: 19528587
[2]	Romero J, Benavides E, Meza C. Assessing financial impacts of subclinical mastitis on Colombian dairy farms[J]. Frontiers in Veterinary Science, 2018, 5:273.doi:10.3389/fvets.2018.00273. pmid: 30542654
[3]	Zadoks R N, Middleton J R, McDougall S, Katholm J, Schukken Y H. Molecular epidemiology of mastitis pathogens of dairy cattle and comparative relevance to humans[J]. Journal of Mammary Gland Biology and Neoplasia, 2011, 16(4):357-372.doi:10.1007/s10911-011-9236-y. pmid: 21968538
[4]	Gao J, Barkema H W, Zhang L M, Liu G, Deng Z J, Cai L J, Shan R X, Zhang S Y, Zou J Q, Kastelic J P, Han B. Incidence of clinical mastitis and distribution of pathogens on large Chinese dairy farms[J]. Journal of Dairy Science, 2017, 100(6):4797-4806.doi:10.3168/jds.2016-12334. pmid: 28434736
[5]	Nair L, Chung H, Basu U. Regulation of long non-coding RNAs and genome dynamics by the RNA surveillance machinery[J]. Nature Reviews Molecular Cell Biology, 2020, 21(3):123-136.doi:10.1038/s41580-019-0209-0. pmid: 32020081
[6]	Wang W L, Min L, Qiu X Y, Wu X M, Liu C Y, Ma J X, Zhang D Y, Zhu L Y. Biological function of long non-coding RNA(LncRNA)xist[J]. Frontiers in Cell and Developmental Biology, 2021, 9:645647.doi:10.3389/fcell.2021.645647.
[7]	Wang K C, Chang H Y. Molecular mechanisms of long noncoding RNAs[J]. Molecular Cell, 2011, 43(6):904-914.doi:10.1016/j.molcel.2011.08.018. pmid: 21925379
[8]	Ma T T, Li H W, Liu H, Peng Y L, Lin T, Deng Z Y, Jia N, Chen Z Q, Wang P. Neat1 promotes acute kidney injury to chronic kidney disease by facilitating tubular epithelial cells apoptosis via sequestering miR-129-5p[J]. Molecular Therapy, 2022, 30(10):3313-3332.doi:10.1016/j.ymthe.2022.05.019.
[9]	Liu M, Li W X, Song F X, Zhang L, Sun X J. Silencing of lncRNA MIAT alleviates LPS-induced pneumonia via regulating miR-147a/NKAP/NF-κB axis[J]. Aging, 2020, 13(2):2506-2518.doi:10.18632/aging.202284.
[10]	Tang S A, Cao Y M, Cai Z P, Nie X Y, Ruan J Z, Zhou Z Q, Ruan G F, Zhu Z H, Han W Y, Ding C H. The lncRNA PILA promotes NF-κB signaling in osteoarthritis by stimulating the activity of the protein arginine methyltransferase PRMT1[J]. Science Signaling, 2022, 15(735):eabm6265.doi:10.1126/scisignal.abm6265.
[11]	Wang H, Wang X X, Li X R, Wang Q W, Qing S Z, Zhang Y, Gao M Q. A novel long non-coding RNA regulates the immune response in MAC-T cells and contributes to bovine mastitis[J]. The FEBS Journal, 2019, 286(9):1780-1795.doi:10.1111/febs.14783.
[12]	Lin C J, Zhu Y F, Hao Z Y, Xu H J, Li T, Yang J H, Chen X, Chen Y Y, Guo A Z, Hu C M. Genome-wide analysis of LncRNA in bovine mammary epithelial cell injuries induced by Escherichia coli and Staphylococcus aureus[J]. International Journal of Molecular Sciences, 2021, 22(18):9719.doi:10.3390/ijms22189719.
[13]	Wang J P, Hu Q C, Yang J, Luoreng Z M, Wang X P, Ma Y, Wei D W. Differential expression profiles of lncRNA following LPS-induced inflammation in bovine mammary epithelial cells[J]. Frontiers in Veterinary Science, 2021, 8:758488.doi:10.3389/fvets.2021.758488.
[14]	Wang X X, Wang H, Zhang R Q, Li D, Gao M Q. LRRC75A antisense lncRNA1 knockout attenuates inflammatory responses of bovine mammary epithelial cells[J]. International Journal of Biological Sciences, 2020, 16(2):251-263.doi:10.7150/ijbs.38214. pmid: 31929753
[15]	Ma M R, Pei Y F, Wang X X, Feng J X, Zhang Y, Gao M Q. LncRNA XIST mediates bovine mammary epithelial cell inflammatory response via NF-κB/NLRP3 inflammasome pathway[J]. Cell Proliferation, 2019, 52(1):e12525.doi:10.1111/cpr.12525.
[16]	Jiao P, Wang J P, Yang J, Wang X P, Luoreng Z M. Bta-miR-223 targeting the RHOB gene in dairy cows attenuates LPS-induced inflammatory responses in mammary epithelial cells[J]. Cells, 2022, 11(19):3144.doi:10.3390/cells11193144.
[17]	Günther J, Esch K, Poschadel N, Petzl W, Zerbe H, Mitterhuemer S, Blum H, Seyfert H M. Comparative kinetics of Escherichia coli-and Staphylococcus aureus-specific activation of key immune pathways in mammary epithelial cells demonstrates that S.aureus elicits a delayed response dominated by interleukin-6(IL-6)but not by IL-1A or tumor necrosis factor alpha[J]. Infection and Immunity, 2011, 79(2):695-707.doi:10.1128/IAI.01071-10.
[18]	Wu T Y, Wang C, Ding L Y, Shen Y Z, Cui H H, Wang M Z, Wang H R. Arginine relieves the inflammatory response and enhances the casein expression in bovine mammary epithelial cells induced by lipopolysaccharide[J]. Mediators of Inflammation, 2016, 2016:9618795.doi:10.1155/2016/9618795.
[19]	Kempf F, Slugocki C, Blum S E, Leitner G, Germon P. Genomic comparative study of bovine mastitis Escherichia coli[J]. PLoS One, 2016, 11(1):e0147954.doi:10.1371/journal.pone.0147954.
[20]	Yang C, Wang M, Tang X W, Yang H S, Li F N, Wang Y C, Li J Z, Yin Y L. Effect of dietary amylose/amylopectin ratio on intestinal health and cecal microbes' profiles of weaned pigs undergoing feed transition or challenged with Escherichia coli lipopolysaccharide[J]. Frontiers in Microbiology, 2021, 12:693839.doi:10.3389/fmicb.2021.693839.
[21]	Fu Y H, Zhou E S, Liu Z C, Li F Y, Liang D J, Liu B, Song X J, Zhao F Y, Fen X S, Li D P, Cao Y G, Zhang X C, Zhang N S, Yang Z T. Staphylococcus aureus and Escherichia coli elicit different innate immune responses from bovine mammary epithelial cells[J]. Veterinary Immunology and Immunopathology, 2013, 155(4):245-252.doi:10.1016/j.vetimm.2013.08.003.
[22]	Fusco R, Cordaro M, Siracusa R, Peritore A F, D'Amico R, Licata P, Crupi R, Gugliandolo E. Effects of hydroxytyrosol against lipopolysaccharide-induced inflammation and oxidative stress in bovine mammary epithelial cells:a natural therapeutic tool for bovine mastitis[J]. Antioxidants, 2020, 9(8):693.doi:10.3390/antiox9080693.
[23]	Zhang X J, Jia F, Ma W W, Li X Q, Zhou X Z. DAD3 targets ACE2 to inhibit the MAPK and NF-κB signalling pathways and protect against LPS-induced inflammation in bovine mammary epithelial cells[J]. Veterinary Research, 2022, 53(1):104.doi:10.1186/s13567-022-01122-0. pmid: 36482404
[24]	Gil N, Ulitsky I. Regulation of gene expression by Cis-acting long non-coding RNAs[J]. Nature Reviews Genetics, 2020, 21(2):102-117.doi:10.1038/s41576-019-0184-5.
[25]	Joung J, Engreitz J M, Konermann S, Abudayyeh O O, Verdine V K, Aguet F, Gootenberg J S, Sanjana N E, Wright J B, Fulco C P, Tseng Y Y, Yoon C H, Boehm J S, Lander E S, Zhang F. Genome-scale activation screen identifies a lncRNA locus regulating a gene neighbourhood[J]. Nature, 2017, 548(7667):343-346.doi:10.1038/nature23451.
[26]	Sun M, Kraus W L. From discovery to function:the expanding roles of long noncoding RNAs in physiology and disease[J]. Endocrine Reviews, 2015, 36(1):25-64.doi:10.1210/er.2014-1034.
[27]	Li B, Xi P P, Wang Z L, Han X G, Xu Y Y, Zhang Y S, Miao J F. PI3K/Akt/mTOR signaling pathway participates in Streptococcus uberis-induced inflammation in mammary epithelial cells in concert with the classical TLRs/NF-κB pathway[J]. Veterinary Microbiology, 2018, 227:103-111.doi:10.1016/j.vetmic.2018.10.031.
[28]	Khan M Z, Khan A, Xiao J X, Ma Y L, Ma J Y, Gao J, Cao Z J. Role of the JAK-STAT pathway in bovine mastitis and milk production[J]. Animals, 2020, 10(11):2107.doi:10.3390/ani10112107.
[29]	Marks Z R C, Campbell N, DeWeerd N A, Lim S S, Gearing L J, Bourke N M, Hertzog P J. Properties and functions of the novel type I interferon epsilon[J]. Seminars in Immunology, 2019, 43:101328.doi:10.1016/j.smim.2019.101328.
[30]	Xin P, Xu X Y, Deng C J, Liu S, Wang Y Z, Zhou X G, Ma H X, Wei D H, Sun S Q. The role of JAK/STAT signaling pathway and its inhibitors in diseases[J]. International Immunopharmacology, 2020, 80:106210.doi:10.1016/j.intimp.2020.106210.
[31]	Banerjee S, Biehl A, Gadina M, Hasni S, Schwartz D M. JAK-STAT signaling as a target for inflammatory and autoimmune diseases:current and future prospects[J]. Drugs, 2017, 77(5):521-546.doi:10.1007/s40265-017-0701-9.
[32]	Han H S, Shin J S, Lee S B, Park J C, Lee K T. Cirsimarin,a flavone glucoside from the aerial part of Cirsium japonicum var.ussuriense(Regel)Kitam.ex Ohwi,suppresses the JAK/STAT and IRF-3 signaling pathway in LPS-stimulated RAW 264.7 macrophages[J]. Chemico-Biological Interactions, 2018, 293:38-47.doi:10.1016/j.cbi.2018.07.024.
[33]	He Y, Dan Y J, Gao X R, Huang L, Lü H B, Chen J. DNMT1-mediated lncRNA MEG3 methylation accelerates endothelial-mesenchymal transition in diabetic retinopathy through the PI3K/Akt/mTOR signaling pathway[J]. American Journal of Physiology Endocrinology and Metabolism, 2021, 320(3):E598-E608.doi:10.1152/ajpendo.00089.2020.
[34]	Cai R, Sun Y M, Qimuge N, Wang G Q, Wang Y Q, Chu G Y, Yu T Y, Yang G S, Pang W J. Adiponectin AS lncRNA inhibits adipogenesis by transferring from nucleus to cytoplasm and attenuating adiponectin mRNA translation[J]. Biochimica et Biophysica Acta Molecular and Cell Biology of Lipids, 2018, 1863(4):420-432.doi:10.1016/j.bbalip.2018.01.005.
[35]	Sun Q Y, Hao Q Y, Prasanth K V. Nuclear long noncoding RNAs:key regulators of gene expression[J]. Trends in Genetics, 2018, 34(2):142-157.doi:10.1016/j.tig.2017.11.005.
[36]	Zhang X L, Cheng Z X, Wang L X, Jiao B L, Yang H, Wang X. MiR-21-3p centric regulatory network in dairy cow mammary epithelial cell proliferation[J]. Journal of Agricultural and Food Chemistry, 2019, 67(40):11137-11147.doi:10.1021/acs.jafc.9b04059. pmid: 31532202
[37]	Liu L H, Sun B, Zhang F, Zhong Z Y, Zhang Y L, Li F, Zhang T T, Khatib H, Wang X. lncRNA MPFAST promotes proliferation and fatty acid synthesis of bovine mammary epithelial cell by sponging miR-103 regulating PI3K-AKT pathway[J]. Journal of Agricultural and Food Chemistry, 2022, 70(38):12004-12013.doi:10.1021/acs.jafc.2c04789. pmid: 36112519
[38]	Chen Z, Liang Y, Lu Q Y, Nazar M, Mao Y J, Aboragah A, Yang Z P, Loor J J. Cadmium promotes apoptosis and inflammation via the circ08409/miR-133a/TGFB2 axis in bovine mammary epithelial cells and mouse mammary gland[J]. Ecotoxicology and Environmental Safety, 2021, 222:112477.doi:10.1016/j.ecoenv.2021.112477.
[39]	Shandilya U K, Wu X, McAllister C, Mutharia L, Karrow N A. Role of toll-like receptor 4 in Mycobacterium avium subsp.paratuberculosis infection of bovine mammary epithelial(MAC-T)cells in vitro[J]. Microbiology Spectrum, 2023, 11(2):e0439322.doi:10.1128/spectrum.04393-22.
[40]	胡启超. miR-375在奶牛乳腺上皮细胞炎症反应中的作用研究[D]. 银川: 宁夏大学, 2021.doi:10.27257/d.cnki.gnxhc.2021.001339.
	Hu Q C. Study on the role of miR-375 in inflammatory reaction of mammary epithelial cells in dairy cows[D]. Yinchuan: Ningxia University, 2021.
[41]	Fan Y L, Arbab A A I, Zhang H M, Yang Y, Lu X B, Han Z Y, Yang Z P. MicroRNA-193a-5p regulates the synthesis of polyunsaturated fatty acids by targeting fatty acid desaturase 1(FADS1)in bovine mammary epithelial cells[J]. Biomolecules, 2021, 11(2):157.doi:10.3390/biom11020157.

Please choose a citation manager

Content to export